Questions tagged [dna-methylation]

A methyl group can be added to a cytosine residue, usually one that neighbors a guanine (known as a CpG - cytosine-phosphate-guanine - site). This can affect chromatin and histone structures, as well as directly influencing binding of various factors, thereby altering the transcription of genes.

Filter by
Sorted by
Tagged with
1
vote
1answer
28 views

General Enhancer Questions (Methylation Patterns, ect.)

I have a biological question(s) for ya'll involving enhancers. 1.) Enhancers work by being the binding sites for TFs. But how does this increase transcription? (Especially when enhancers can be ...
1
vote
0answers
27 views

Does the consistency of Horvath's clock across different tissues suggest anything about aging?

Horvath's clock estimates the chronological age of people based on the methylation of 353 CpG sites. It is noted for its unprecedented accuracy (median error of 3.6 years) and consistency across ...
2
votes
1answer
91 views

What is the relationship between induction of cell differentiation and DNA methylation status?

This may sound like a broad question to ask, but I am working on interpreting a review article for my epigenetics course and I'm having trouble reconciling two seemingly contradictory things this ...
-1
votes
1answer
109 views

what is CpG coverage? DNA starting material?

referring to this quote from an article about predicting methylation states: "Because of the small amounts of genomic DNA starting material per cell, single-cell methylation analyses are ...
3
votes
2answers
352 views

How does alternative splicing work?

I am trying to find out what controls what exons are spliced out, and I keep coming across the term cis regulator, but I cannot seem to find a clear explanation of what happens... Thank you in ...
0
votes
1answer
61 views

DNA methylation in different positions

I'm trying to understand how does DNA methylation and histone methylation status of promoters differs given their position in a gene? Does position affect whether they are repressive or activating?
3
votes
2answers
1k views

DNA methylation on the forward vs reverse strand?

I'm wondering if there are meant to be differences in DNA methylation between the forward and the reverse strand of the gene? I'm wondering because in primer design for bisulfite pyrosequencing one ...
1
vote
1answer
222 views

How do you read the histone code?

I took it upon myself to research how methylation/acetylation affects histone tails via post-translational modifications. However, I find myself confused about how to "read" this histone code, ...
0
votes
0answers
123 views

How do cells become differentiated using epigenetics despite having the same genome?

How is epigenetics used in the differentiation of cells and is this the only thing that is used? I've seen that transcription factors play a role but are these simply proteins that initially write the ...
0
votes
1answer
179 views

Can DNA methylation induce breast cancer? [closed]

What is the role of DNA methylation in breast cancer? DNA methylation is a process by which methyl groups are added to the DNA molecule. In the September 2015 paper The Role of Methylation in Breast ...
2
votes
0answers
30 views

Fisher's Method to melt p-values for CpG sites annotated to the same gene?

I have some data I am working with, and I am curious if I am able to combine p-values from a paired t-test for CpG sites in the genome using Fisher's Method to get one p-value for each unique gene. ...
5
votes
1answer
117 views

Spermatogenesis in humans - timing of phases and chromatin modifications

I'm interested in the timing of events during human spermatogenesis, ideally with some references I can build off of. Specifically, I am trying to pin down the number of days for: Spermatogenesis, ...
4
votes
3answers
5k views

DpnI over-digestion

We have a long protocol that we are optimizing that includes DpnI digestion of a PCR product (to remove any of the template DNA if it's methylated, and while we're not certain in the blind tests, ...
4
votes
1answer
46 views

Gene silencing: relative or absolute number of methylated CpG sites?

CpG content varies a lot across the human genome. What does determine a promoter to be silenced through DNA methylation: the fraction of CpG sites that are methylated or the total number of methylated ...
2
votes
1answer
197 views

How does CpG island methylation lead to gene silencing?

I see often the blanket statement that CpG island methylation can lead to gene silencing. However, I have been unable to find a straightforward explanation of the mechanism by this. Is it a purely ...
1
vote
0answers
24 views

If a promoter region of a gene is transcribed, can it get methylated?

Deletion of a transcription termination site can lead to a downstream gene's promoter region being transcribed. What if that portion of the mRNA acts like an siRNA methyltransferase recruiter?
3
votes
1answer
112 views

What does “cell type composition” mean?

I am reading an article about detection of differential methylation. They use the term "cell type composition" in the following context: "Researchers need to carefully design studies that associate ...
1
vote
1answer
2k views

Why use RRBS (reduced representation bisulfite sequencing) instead of general BiSeq?

My understanding is that RRBS is used for certain cases. For example, WGBS (whole genome bisulfite sequencing) is limited by repeated sequences. However, many papers seem to use both techniques. ...
1
vote
0answers
58 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
1
vote
1answer
40 views

Cell-type specific methylation profiles: original reference finding?

This is a general question, and a specific question. I'm looking for the original reference that first talked about how DNA methylation profiles are cell-type specific. This is specific, because I ...
1
vote
1answer
118 views

Methylation Data for Erythrocytes (Red Blood Cells)?

Why is it that white blood cells (leukocytes) are highly characterized in DNA methylation pure cell line profiling, but I can't find any profiles of red blood cells (erythrocytes)? Is blood considered ...
5
votes
1answer
59 views

One Sample, Different Methylation Values

I'm hoping that somebody here can explain this unusual result that I'm getting with some pyrosequencing data. I have bisulphite converted a few samples a couple of times over the years for different ...
3
votes
0answers
32 views

Why there are two rounds of cytosine de-methylation in mammalian development?

I assume that the key biological meaning of cytosine de-methylation during germline development in germline progenitor cells is to reset imprinted genes and then set methylation pattern on these genes ...
2
votes
0answers
63 views

Genome-wide methylation analysis: sources of technical error?

We are doing a genome-wide analysis of methylation via bisulfite sequencing for an insect species. Previous experimental techniques have suggested the presence of methylation in this organism, ...
2
votes
1answer
223 views

How correlated are proximally related CpG sites in human DNA?

Cytosine residues in DNA that can be methylated (i.e. CpG sites) are likely to be in the same methylation state if they are geographically (proximally) close together. I can only find one paper that ...