Questions tagged [dna-methylation]

A methyl group can be added to a cytosine residue, usually one that neighbors a guanine (known as a CpG - cytosine-phosphate-guanine - site). This can affect chromatin and histone structures, as well as directly influencing binding of various factors, thereby altering the transcription of genes.

9 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
3
votes
0answers
32 views

Why there are two rounds of cytosine de-methylation in mammalian development?

I assume that the key biological meaning of cytosine de-methylation during germline development in germline progenitor cells is to reset imprinted genes and then set methylation pattern on these genes ...
2
votes
0answers
63 views

Genome-wide methylation analysis: sources of technical error?

We are doing a genome-wide analysis of methylation via bisulfite sequencing for an insect species. Previous experimental techniques have suggested the presence of methylation in this organism, ...
1
vote
0answers
27 views

Does the consistency of Horvath's clock across different tissues suggest anything about aging?

Horvath's clock estimates the chronological age of people based on the methylation of 353 CpG sites. It is noted for its unprecedented accuracy (median error of 3.6 years) and consistency across ...
1
vote
0answers
30 views

Fisher's Method to melt p-values for CpG sites annotated to the same gene?

I have some data I am working with, and I am curious if I am able to combine p-values from a paired t-test for CpG sites in the genome using Fisher's Method to get one p-value for each unique gene. ...
1
vote
0answers
24 views

If a promoter region of a gene is transcribed, can it get methylated?

Deletion of a transcription termination site can lead to a downstream gene's promoter region being transcribed. What if that portion of the mRNA acts like an siRNA methyltransferase recruiter?
1
vote
0answers
60 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
0answers
15 views

Can damage from stress hormones/distress be reversed?

Emotional distress is said and scientifically even validated that it could contribute to earlier aging, even aside from chronological age. Stresses also can have millions of pathways in which they can ...
0
votes
0answers
128 views

How do cells become differentiated using epigenetics despite having the same genome?

How is epigenetics used in the differentiation of cells and is this the only thing that is used? I've seen that transcription factors play a role but are these simply proteins that initially write the ...
-1
votes
1answer
112 views

what is CpG coverage? DNA starting material?

referring to this quote from an article about predicting methylation states: "Because of the small amounts of genomic DNA starting material per cell, single-cell methylation analyses are ...