Stack Exchange Network

Stack Exchange network consists of 174 Q&A communities including Stack Overflow, the largest, most trusted online community for developers to learn, share their knowledge, and build their careers.

Visit Stack Exchange

Questions tagged [epigenetics]

Mechanisms for inheriting phenotype outside of the genomic DNA sequence.

1
vote
0answers
7 views

why nucleosome spacing is longer in heterochromatin than euchromatin

Heterochromatin is defined as tightly packed form of DNA. But some experiments show that the average spacing of nucleosomes associated with H3K9me3 and H3K27me3, both heterochromatin marks, are longer ...
0
votes
1answer
37 views

Do epigenetics determine the proteins a cell produces and therefore it's function?

I'm having trouble understanding what epigenetics is in a simple sense. How I imagine it is that if we had 2 twins with identical DNA and we let them live we will see that they'll develop differently....
2
votes
0answers
47 views

Is there any example of genetic mechanism of delayed onset toxic effects?

We know that exposure to many toxic chemicals during embryonic development may show toxic effects later in life. It is called Developmental Origins of Health and Disease (DOHAD). Most of the ...
2
votes
2answers
61 views

Semantics Question: epigenetic mark on a person's DNA?

In an article on biomarkers of child abuse, the author referred to an "epigenetic mark on a person's DNA". It's a popular science article, so the language may reflect a combination of the journalist's ...
1
vote
1answer
44 views

Can supplements affect DNA? (Could 10,000% Methylcobalamin affect MTHFR genotype)

Originally titled "Could B12 supplementation affect dna test results for B12 need?" - B12 just seems like a good example question to frame the more general question of "Can supplements affect DNA?" I ...
1
vote
0answers
18 views

Does the consistency of Horvath's clock across different tissues suggest anything about aging?

Horvath's clock estimates the chronological age of people based on the methylation of 353 CpG sites. It is noted for its unprecedented accuracy (median error of 3.6 years) and consistency across ...
2
votes
1answer
53 views

What is the relationship between induction of cell differentiation and DNA methylation status?

This may sound like a broad question to ask, but I am working on interpreting a review article for my epigenetics course and I'm having trouble reconciling two seemingly contradictory things this ...
0
votes
1answer
92 views

epigenetic vs. environmental factors

I'm trying to understand the difference between epigenetic and environmental factors. For example, if gene A increases the risk of lung cancer by 50% and smoking increases the risk by another 75% when ...
0
votes
0answers
67 views

how does environment affect methylation status in dna

There are many examples where environmental stress can induce changes in gene activation and deactivation. I find in many examples that the DNA methylation status of cytosine is changed to on or off ...
0
votes
0answers
37 views

Any idea about CRISPR-based gene activation in plants using p300 Acetyltransferase or Tet1 Demethylase?

We are planning to use CRISPR tools as RNP for epigenetic studies in plants. To this end, I'm wondering if bacterial production of dCas9 fused to the catalytic domain of p300 acetyltransferase or Tet1 ...
3
votes
1answer
157 views

How can epigenetic changes be erased if they are inherited?

I’m a little bit confused about DNA methlyation reprogramming and about the nature of an epigenetic phenomenon. According to Wikipedia: After fertilization the paternal and maternal genomes are ...
0
votes
0answers
58 views

How do epigenetics influence fat distribution?

Can our environment, diet, exercise, etc. influence the cell signaling of fat cells - basically, can someone who is apple shaped turn into a pear shape? I've seen the opposite happen (pear to apple) ...
1
vote
0answers
51 views

What kind of code is neural code? [closed]

It's rather clear and commonsensical what the genetic code is, how it is inscribed (as a sequence of nucleotides in the DNA), what it means, and most of all: how it is decoded and works. It's less ...
2
votes
2answers
93 views

“50% of the variance in antisocial phenotypes is the result of genetic factors” means what?

How can i understand the following sentence: Overall, the conclusions reached by these studies have been highly consistent in showing that approximately 50% of the variance in antisocial phenotypes ...
0
votes
0answers
91 views

How do cells become differentiated using epigenetics despite having the same genome?

How is epigenetics used in the differentiation of cells and is this the only thing that is used? I've seen that transcription factors play a role but are these simply proteins that initially write the ...
0
votes
1answer
54 views

DNA methylation in different positions

I'm trying to understand how does DNA methylation and histone methylation status of promoters differs given their position in a gene? Does position affect whether they are repressive or activating?
0
votes
1answer
404 views

Is protein production doubled if you have homozygous dominant genes as opposed to heterozygous genes?

At school we were taught in quite simplistic terms. We were told that there is a dominant and recessive type of every gene and that if the dominant gene was present, the protein is produced and if it ...
1
vote
2answers
150 views

Is there any biological basis for the emphasis on the value of the firstborn son?

Is the firstborn son biologically different in any way from the sons that follow? Perhaps his epigenome is different? I have heard that a man's testosterone levels decrease when he becomes a father --...
1
vote
0answers
83 views

Have researchers discovered how epigenetic information is passed down during cell division?

For example, how are histone code patterns passed down? This question was asked a few years ago in this thread: How are epigenetic marks transmitted during cell division? However, it has been a few ...
1
vote
0answers
31 views

On parents' similarity

I don't know if this is a real claim, I live in Mexico City and most of the people I know are more similar to their father than to their mother? Why is that? Are the x and y cromosomes somehow related ...
2
votes
0answers
31 views

Is there any technique can quickly expand one set of cell chromosomes?

Assume a cell type is very scarce while isolated out and hard to expand in vitro, and I wanna have more of its chromosomes, is there any technique , in vivo or in vitro or ex vitro, any would count, ...
2
votes
1answer
167 views

How does CpG island methylation lead to gene silencing?

I see often the blanket statement that CpG island methylation can lead to gene silencing. However, I have been unable to find a straightforward explanation of the mechanism by this. Is it a purely ...
1
vote
1answer
123 views

Can epigenetic structures carry a trait?

Can epigenetic structures cause a trait to manifest in a person if the trait is not already in the DNA? In all my readings I have yet to find a definitive statement that it is impossible.
0
votes
0answers
62 views

can genetic material actually provide a physical description of appearance?

A bodies genetic material provides the blueprint for your appearance. Your predisposition to be tall, freckled, blue eyed and blonde are encoded from birth. However, external and environmental ...
3
votes
2answers
177 views

Can a gene-expression or epigenetic 'user-history' be found in the body?

(EDITED - a lot of what I am saying is implicit and simplified. I'm not looking to recreate the numerous textbooks and scientific papers on how DNA works). As far as I can understand it, an ...
5
votes
1answer
103 views

Spermatogenesis in humans - timing of phases and chromatin modifications

I'm interested in the timing of events during human spermatogenesis, ideally with some references I can build off of. Specifically, I am trying to pin down the number of days for: Spermatogenesis, ...
2
votes
4answers
269 views

Are enhancers and silencers considered as epigenetic modifications?

Are enhancers and silencers considered as epigenetic modifications? I am confused as it seems like enhancers and silencers are sequences on the DNA and how they work is through binding with proteins, ...
4
votes
4answers
696 views

Is post-transcriptional regulation of gene expression an epigenetic process?

Is post-transcriptional regulation of gene expression (for example regulation by microRNAs) a type of epigenetic gene expression regulation? I think we can categorize it as epigenetic since the DNA ...
2
votes
1answer
2k views

How to confirm pure-breeding parents

I was reading Genetic Analysis (Sanders, Bowman) and saw the following figure summarizing the 1909 work of Herman Nilsson-Ehle in describing the genetic control of kernel color in wheat: How did ...
1
vote
1answer
72 views

Allele-specific bisulfite sequencing

When evaluating methylation status at various CpG sites after sequencing, how much consideration should one give to random single base pair insertions and deletions. Suppose there is a CA dinucleotide;...
0
votes
0answers
34 views

How effective will the synthesized virus be without epigenetic marks?

Will a de-novo synthesize infectious virus be as effective as the natural one? How important are epigenetic marks for the virus and is there a mechanism to restore them?
2
votes
0answers
51 views

Can the restless leg syndrome may have been caused due to natural selection? [closed]

Disclaimer: I don't know how much restless the leg has to be, in order to be considered a syndrome. RLS runs not only in my family but also several people in the locality. My hypothesis is that RLS ...
5
votes
1answer
524 views

Does the bending of a tree's trunk in the wind stimulate and strengthen root growth?

Recently Southern California experienced extreme wind velocities and afterwards the news reported over 300 trees had fallen in San Diego County. I had either heard or read somewhere that the action of ...
4
votes
2answers
232 views

Are epigenetic changes involved in evolution?

Evolution leads to phenotypic changes through changes in DNA such as mutations. Mutations are transmitted to offspring. Cumulative mutational changes across many generations may cause evolution and ...
1
vote
1answer
82 views

Difference between micro RNA and short-interfering RNA and CRISPR Cas 9 system?

I read this article https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/ and am slightly puzzled as to why the CRISPR/Cas 9 system is seen as being so revolutionary. It seems like the ...
2
votes
0answers
103 views

Epigenetics and serotonin?

In this article http://www.nature.com/neuro/journal/v17/n9/full/nn.3778.html it states that Increased promoter methylation of the serotonin transporter gene predicted increased threat related ...
1
vote
2answers
394 views

Prader-Willi Syndrome and Angelman Syndrome?

On the website http://www.whatisepigenetics.com/fundamentals/2/ it states that the imprint disorders Prader-Willi syndrome and Angelman syndrome, display an abnormal phenotype as a result of the ...
1
vote
0answers
55 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
0answers
48 views

Function and Mechanism of Height Genes

I have an inquiry regarding the exact function of height genes. To my knowledge, although they are heavily regulated by epigenetic factors, height genes can have either an "on" or an "off" allele, ...
4
votes
2answers
184 views

Genetic Imprinting and Cell differentiation

It does not seem possible that these two processes can coexist: 1) Genetic imprinting is the phenomenon where genes are expressed differently depending on the parent of origin: 1a. Methylated ...
8
votes
2answers
212 views

Is there a genomic code for nucleosome positioning?

What does a genomic code for nucleosome positioning in eukaryotes actually mean? By the code is it right to think that specific DNA sequences favour nucleosomes and others don't? I see that there for ...
5
votes
1answer
125 views

Doubt on genomic code for nucleosome positioning?

I was reading "A genomic code for nucleosome positioning" (by Eran Segal et al). And I am having 2 doubts. The figure(b) in this image from the paper shows the graph of fraction (3-bp moving average) ...
3
votes
1answer
146 views

Do human visual functions degenerate due to genetic factors or by external factors?

Does eyesight primarily deteriorate 'naturally' due to genetics (genomic/epigenomic factors), or due to external factors such as normal wear and tear, or disease? By normal wear and tear I include ...
3
votes
2answers
929 views

DNA methylation on the forward vs reverse strand?

I'm wondering if there are meant to be differences in DNA methylation between the forward and the reverse strand of the gene? I'm wondering because in primer design for bisulfite pyrosequencing one ...
3
votes
0answers
522 views

Does the Jungian notion of collective unconsciousness have any legitimacy in the light of modern neurobiology and epigenetics?

Carl Jung has long ago proposed a rather controversial notion of collective unconsciousness [1, 2, 3], a form of the unconscious (that part of the mind containing memories and impulses of which ...
4
votes
1answer
127 views

X-inactivation in ovaries

Background In all eutherian (mammals excluding the marsupials), the female (who is $XX$ for the pair of sexual chromosomes) inactivates one of her $X$. This is called dosage compensation. This ...
3
votes
1answer
6k views

What is the purpose of back-crossing mice for multiple generations?

Occasionally I will come across articles that refer to back-crossing mice of one strain onto the background other another strain (e.g., C57Bl6). They do not explicitly state the purpose for doing so, ...
1
vote
1answer
47 views

psychological database with sequenced DNA records

I'm looking for an epigenetic database which includes for each example the psychological history of the persons DNA. Right now I can only find DNA and epigenetic databases. Sadly none of the databases ...
2
votes
2answers
876 views

Why is the human body hair not uniformly colored?

Most of my body hair is black however my lip hair is light brown/blonde the rest of my beard region is black. Since hair color is genetic what causes this?
1
vote
1answer
111 views

Omics integration questions [closed]

Let's say that I have a population of Mus musculus in the lab. I divide it in a control group and a test group. The test group is constantly subjected to a stress (example: elevated UV radiation). ...