Questions tagged [epigenetics]

Mechanisms for inheriting phenotype outside of the genomic DNA sequence.

Filter by
Sorted by
Tagged with
0
votes
0answers
36 views

Lamarck’s experimental proof of use and disuse(I hope someone can judge my design) [closed]

Since I studied the Weisman mouse experiment in high school, I have been very skeptical about his experiment. Over the years, I have inquired about the relevant materials and have my own ideas, but I ...
0
votes
1answer
30 views

Studying the epigenetic variability, can I use SNPs?

So, I'm trying to study the effects of epigenetic variability on the brain structure. Can I use SNPs associated with a gene's higher expression to compute the likelihood of that gene being expressed ...
-1
votes
0answers
18 views

Buffer Components affect DNA methylation patterns?

I am using this buffer to preserve blood cells for long term storage. The buffer contains the following: 100 mM Tris, 100 mM EDTA, 10 mM NaCl, and 0.5% SDS. From the literature it seems that EDTA ...
0
votes
0answers
22 views

what causes epigenetic dysregulation in cancer?

Do mutations in regulatory gene sequences lead to changes in epigenetic alterations in cancer, and if so which ones? I know abnormal hypermethylation of GCP islands occurs in promoters of tumour ...
2
votes
1answer
43 views

Are epigenetic modifications the most stable mechanisms for cell differentiation?

Wondering what the general take is on what are the molecular mechanisms that are mostly responsible for cell type differentiation stability; ie, for a cell's identity to actually become 'locked in' ...
-1
votes
1answer
76 views

Is it possible to change the DNA of all the cells of an adult human [closed]

The process of making and transferring changes is pretty straightforward relatively speaking in an embroyo. You change the DNA of one cell and all the cells now inherit this change. But let's say ...
1
vote
2answers
26 views

Is there natural occurrence of induced pluripotency / expression of Yamanaka factors and what is the evolutionary explanation of that?

Is there natural biological processes in which the full (full reprogramming into pluripotent state) or partial (partial reprogramming, stopped before point-of-no-return, preserving the functional ...
1
vote
0answers
26 views

Techniques of molecular medicine/biology for aesthetic medicine?

Are there scientifically valid methods (possibly in the developmental stage) that can be used for aesthetic medicine. Usually surgical of physical therapies are used for aesthetic medicine, but ...
0
votes
0answers
36 views

Mitosis of inactivated X chromosome

How is the inactivation of one of the X chromosomes preserved/propagated when the cell replicates? Background: In the XX/XY system of sex determination (i.e. mammals and marsupials), in female ...
1
vote
0answers
20 views

why nucleosome spacing is longer in heterochromatin than euchromatin

Heterochromatin is defined as tightly packed form of DNA. But some experiments show that the average spacing of nucleosomes associated with H3K9me3 and H3K27me3, both heterochromatin marks, are longer ...
0
votes
1answer
123 views

Do epigenetics determine the proteins a cell produces and therefore it's function?

I'm having trouble understanding what epigenetics is in a simple sense. How I imagine it is that if we had 2 twins with identical DNA and we let them live we will see that they'll develop differently....
2
votes
0answers
66 views

Is there any example of genetic mechanism of delayed onset toxic effects?

We know that exposure to many toxic chemicals during embryonic development may show toxic effects later in life. It is called Developmental Origins of Health and Disease (DOHAD). Most of the ...
2
votes
2answers
128 views

Semantics Question: epigenetic mark on a person's DNA?

In an article on biomarkers of child abuse, the author referred to an "epigenetic mark on a person's DNA". It's a popular science article, so the language may reflect a combination of the journalist's ...
1
vote
1answer
56 views

Can supplements affect DNA? (Could 10,000% Methylcobalamin affect MTHFR genotype)

Originally titled "Could B12 supplementation affect dna test results for B12 need?" - B12 just seems like a good example question to frame the more general question of "Can supplements affect DNA?" I ...
1
vote
0answers
26 views

Does the consistency of Horvath's clock across different tissues suggest anything about aging?

Horvath's clock estimates the chronological age of people based on the methylation of 353 CpG sites. It is noted for its unprecedented accuracy (median error of 3.6 years) and consistency across ...
2
votes
1answer
74 views

What is the relationship between induction of cell differentiation and DNA methylation status?

This may sound like a broad question to ask, but I am working on interpreting a review article for my epigenetics course and I'm having trouble reconciling two seemingly contradictory things this ...
0
votes
1answer
128 views

epigenetic vs. environmental factors

I'm trying to understand the difference between epigenetic and environmental factors. For example, if gene A increases the risk of lung cancer by 50% and smoking increases the risk by another 75% when ...
3
votes
1answer
202 views

How can epigenetic changes be erased if they are inherited?

I’m a little bit confused about DNA methlyation reprogramming and about the nature of an epigenetic phenomenon. According to Wikipedia: After fertilization the paternal and maternal genomes are ...
1
vote
0answers
62 views

What kind of code is neural code? [closed]

It's rather clear and commonsensical what the genetic code is, how it is inscribed (as a sequence of nucleotides in the DNA), what it means, and most of all: how it is decoded and works. It's less ...
2
votes
2answers
112 views

“50% of the variance in antisocial phenotypes is the result of genetic factors” means what?

How can i understand the following sentence: Overall, the conclusions reached by these studies have been highly consistent in showing that approximately 50% of the variance in antisocial phenotypes ...
0
votes
0answers
123 views

How do cells become differentiated using epigenetics despite having the same genome?

How is epigenetics used in the differentiation of cells and is this the only thing that is used? I've seen that transcription factors play a role but are these simply proteins that initially write the ...
0
votes
1answer
61 views

DNA methylation in different positions

I'm trying to understand how does DNA methylation and histone methylation status of promoters differs given their position in a gene? Does position affect whether they are repressive or activating?
0
votes
1answer
601 views

Is protein production doubled if you have homozygous dominant genes as opposed to heterozygous genes?

At school we were taught in quite simplistic terms. We were told that there is a dominant and recessive type of every gene and that if the dominant gene was present, the protein is produced and if it ...
1
vote
2answers
157 views

Is there any biological basis for the emphasis on the value of the firstborn son?

Is the firstborn son biologically different in any way from the sons that follow? Perhaps his epigenome is different? I have heard that a man's testosterone levels decrease when he becomes a father --...
1
vote
0answers
88 views

Have researchers discovered how epigenetic information is passed down during cell division?

For example, how are histone code patterns passed down? This question was asked a few years ago in this thread: How are epigenetic marks transmitted during cell division? However, it has been a few ...
1
vote
0answers
32 views

On parents' similarity

I don't know if this is a real claim, I live in Mexico City and most of the people I know are more similar to their father than to their mother? Why is that? Are the x and y cromosomes somehow related ...
1
vote
0answers
32 views

Is there any technique can quickly expand one set of cell chromosomes?

Assume a cell type is very scarce while isolated out and hard to expand in vitro, and I wanna have more of its chromosomes, is there any technique , in vivo or in vitro or ex vitro, any would count, ...
2
votes
1answer
196 views

How does CpG island methylation lead to gene silencing?

I see often the blanket statement that CpG island methylation can lead to gene silencing. However, I have been unable to find a straightforward explanation of the mechanism by this. Is it a purely ...
1
vote
1answer
145 views

Can epigenetic structures carry a trait?

Can epigenetic structures cause a trait to manifest in a person if the trait is not already in the DNA? In all my readings I have yet to find a definitive statement that it is impossible.
0
votes
0answers
87 views

can genetic material actually provide a physical description of appearance?

A bodies genetic material provides the blueprint for your appearance. Your predisposition to be tall, freckled, blue eyed and blonde are encoded from birth. However, external and environmental ...
3
votes
2answers
242 views

Can a gene-expression or epigenetic 'user-history' be found in the body?

(EDITED - a lot of what I am saying is implicit and simplified. I'm not looking to recreate the numerous textbooks and scientific papers on how DNA works). As far as I can understand it, an ...
5
votes
1answer
116 views

Spermatogenesis in humans - timing of phases and chromatin modifications

I'm interested in the timing of events during human spermatogenesis, ideally with some references I can build off of. Specifically, I am trying to pin down the number of days for: Spermatogenesis, ...
2
votes
4answers
383 views

Are enhancers and silencers considered as epigenetic modifications?

Are enhancers and silencers considered as epigenetic modifications? I am confused as it seems like enhancers and silencers are sequences on the DNA and how they work is through binding with proteins, ...
4
votes
4answers
1k views

Is post-transcriptional regulation of gene expression an epigenetic process?

Is post-transcriptional regulation of gene expression (for example regulation by microRNAs) a type of epigenetic gene expression regulation? I think we can categorize it as epigenetic since the DNA ...
2
votes
1answer
3k views

How to confirm pure-breeding parents

I was reading Genetic Analysis (Sanders, Bowman) and saw the following figure summarizing the 1909 work of Herman Nilsson-Ehle in describing the genetic control of kernel color in wheat: How did ...
1
vote
1answer
75 views

Allele-specific bisulfite sequencing

When evaluating methylation status at various CpG sites after sequencing, how much consideration should one give to random single base pair insertions and deletions. Suppose there is a CA dinucleotide;...
1
vote
0answers
37 views

How effective will the synthesized virus be without epigenetic marks?

Will a de-novo synthesize infectious virus be as effective as the natural one? How important are epigenetic marks for the virus and is there a mechanism to restore them?
2
votes
0answers
52 views

Can the restless leg syndrome may have been caused due to natural selection? [closed]

Disclaimer: I don't know how much restless the leg has to be, in order to be considered a syndrome. RLS runs not only in my family but also several people in the locality. My hypothesis is that RLS ...
5
votes
1answer
698 views

Does the bending of a tree's trunk in the wind stimulate and strengthen root growth?

Recently Southern California experienced extreme wind velocities and afterwards the news reported over 300 trees had fallen in San Diego County. I had either heard or read somewhere that the action of ...
4
votes
2answers
256 views

Are epigenetic changes involved in evolution?

Evolution leads to phenotypic changes through changes in DNA such as mutations. Mutations are transmitted to offspring. Cumulative mutational changes across many generations may cause evolution and ...
1
vote
1answer
90 views

Difference between micro RNA and short-interfering RNA and CRISPR Cas 9 system?

I read this article https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/ and am slightly puzzled as to why the CRISPR/Cas 9 system is seen as being so revolutionary. It seems like the ...
2
votes
0answers
112 views

Epigenetics and serotonin?

In this article http://www.nature.com/neuro/journal/v17/n9/full/nn.3778.html it states that Increased promoter methylation of the serotonin transporter gene predicted increased threat related ...
1
vote
2answers
459 views

Prader-Willi Syndrome and Angelman Syndrome?

On the website http://www.whatisepigenetics.com/fundamentals/2/ it states that the imprint disorders Prader-Willi syndrome and Angelman syndrome, display an abnormal phenotype as a result of the ...
1
vote
0answers
57 views

How does one predict the methylation pattern?

Suppose, we have a double stranded DNA like 5' AGCTAGGAGAGACCAGGTTCC 3' 3' TCGATCCTCTCTGGTCCAAGG 5' Where would the methylated cytosine be? Is there any randomness?
0
votes
0answers
51 views

Function and Mechanism of Height Genes

I have an inquiry regarding the exact function of height genes. To my knowledge, although they are heavily regulated by epigenetic factors, height genes can have either an "on" or an "off" allele, ...
4
votes
2answers
208 views

Genetic Imprinting and Cell differentiation

It does not seem possible that these two processes can coexist: 1) Genetic imprinting is the phenomenon where genes are expressed differently depending on the parent of origin: 1a. Methylated ...
8
votes
2answers
292 views

Is there a genomic code for nucleosome positioning?

What does a genomic code for nucleosome positioning in eukaryotes actually mean? By the code is it right to think that specific DNA sequences favour nucleosomes and others don't? I see that there for ...
5
votes
1answer
132 views

Doubt on genomic code for nucleosome positioning?

I was reading "A genomic code for nucleosome positioning" (by Eran Segal et al). And I am having 2 doubts. The figure(b) in this image from the paper shows the graph of fraction (3-bp moving average) ...
3
votes
1answer
196 views

Do human visual functions degenerate due to genetic factors or by external factors?

Does eyesight primarily deteriorate 'naturally' due to genetics (genomic/epigenomic factors), or due to external factors such as normal wear and tear, or disease? By normal wear and tear I include ...
3
votes
2answers
1k views

DNA methylation on the forward vs reverse strand?

I'm wondering if there are meant to be differences in DNA methylation between the forward and the reverse strand of the gene? I'm wondering because in primer design for bisulfite pyrosequencing one ...