If you are looking for information on Coronaviruses, we have prepared this FAQ with information on what is on topic on this site and links to some reputable external resources.

Questions tagged [genetics]

Genetics is the branch of biology that deals with the transmission and variation of inherited characteristics.

Filter by
Sorted by
Tagged with
0
votes
0answers
8 views

How much can you improve performance by selective breeding?

How much can you improve performance by selective breeding? I am curious of all kinds of performance, physical as well as cognitive, but I guess the latter is harder to answer so to make the question ...
0
votes
2answers
41 views

Are human beings capable of producing Covid-19 Virus (SARS-CoV-2) now?

Probably SARS-CoV-2 Wikipedia is not man-made and there is no strong signature it is man-made Wikipedia. Without a real Covid-19 Virus, after knowing its gene sequence, are human beings capable of ...
2
votes
1answer
52 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
0
votes
0answers
31 views

How to purchase a yeast or E. Coli strain expressing a certain protrein?

I'm looking to purchase yeast strains containing Lipase A from the Candida Antarctica fungi. However, I'm not sure where to begin. I know there are sites to purchase cultures from this ResearchGate ...
0
votes
1answer
36 views

Has lamarckism been discredited?

Lamarckism is a pre-darwinian theory according to which an organism's traits acquired to adapt to the environment are passed onto its offspring. A couple of years ago, I attended an event with Richard ...
1
vote
1answer
36 views

Why/How do Cyanobacteria Produce Toxins?

I've been doing some research on the versatility of nitrogen-fixing cyanobacteria, particularly of the genus Anabaena, and I often run into safety hazards and have to add extra steps to my procedures ...
-1
votes
0answers
17 views

Genetics Probability Question [closed]

I got 135/65536 for part a, but I don't know if that's right. I'm very confused about what I'm supposed to do for part b tho. Thanks
-1
votes
0answers
49 views

Are viruses a link between living and non-living things? [closed]

I think they are not since they evolve much later from cells .Is my reasoning right or I am wrong?
-1
votes
0answers
8 views

What is the nature of the mutation in cystic fibrosis? [closed]

I'm doing a genetics research project for cystic fibrosis and the only part I'm left with is the nature of the mutation of the disease. I have tried searching the internet, but I can't any sources. ...
0
votes
0answers
23 views

Are the conclusions in “The proximal origin of SARS-CoV-2” legit? [duplicate]

I don't have any background in genetics and bioinformatics, so I ask you if you think that the arguments provided in the article The proximal origin of SARS-CoV-2 by Andersen et al. are convincing. In ...
-7
votes
0answers
43 views

Could COVID-19 have been created in a lab using the data gained from the reconstructed 1918 Spanish Flu virus? [closed]

The 1918 Spanish Flu Pandemic virus (Influenza A, H1N1) was reconstructed in a CDC laboratory back in 2005. The CDC then published how their researchers were able to accomplish this and the article ...
1
vote
0answers
9 views

What causes the overactivity of collagen production and expression in the cells of the nail bed/ nail matrix after some traumata?

What is the cellular mechanism of traumatic(sterile) onychodystrophy(hypertrophy)? I.e one hits his toenail and has it removed twice( once after the first trauma and then 3 years after the first ...
2
votes
1answer
62 views

CRISPR-Cas9 knockout

With CRISPR-Cas9 I have conducted a targeted knockout of a DNA region encoding a certain protein (working with leukocytes). My question is, how long does it take until this protein is not detectable ...
0
votes
1answer
49 views

Large study showing that attraction to only the same sex has to do with your genes, published where?

Can someone please help me out and find and link me the study from a couple of years ago that showed how only same sex attraction, when the male cant become attracted to a woman, it has to do with ...
0
votes
0answers
41 views

How are Viruses Genetically Modified?

Okay everyone, so I get that you can perform lysis on a bacterium to extract the plasmid, then alter the plasmid using restriction enzymes and ligase, and re insert it back into the bacterium with ...
4
votes
1answer
83 views

What gene targets associated with the new coronavirus (SARS-CoV-2) have been identified so far?

One hypothesis for which we have some supporting evidence is that the new virus (SARS-CoV-2) "enters human cells through an interaction with angiotensin-converting enzyme 2" see here. Although it is ...
1
vote
0answers
17 views

How exactly does DNA polymerase III detect a mismatched base?

How exactly does DNA polymerase III detect a mismatched base? I know how it removes it, via exonuclease activity, but how does it 'detect' it molecularly in the first place?
-1
votes
1answer
70 views

Is it true that if a human lived long enough (up to 3-400 years), he/she would eventually develop cancer?

I have just studied DNA, but I am not so clear. So, I would like you to explain it more clearly. This is what I think when a human grow older and older, his or her DNA repair mechanism would be ...
87
votes
2answers
13k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
9
votes
1answer
78 views

What causes cells to inactivate one X-chromosome?

Normally, when a cell has two X-chromosomes (female genome), one is randomly inactivated. How does the cell detect that there are two X-chromosomes in the first place? Is there some kind of protein ...
1
vote
0answers
20 views

Breakdown of functional human genome by organ/What fraction of the functional human genome is devoted specifically to brain functioning?

Of course, there won't be a precise known answer to the question, as it is not even known precisely what percentage of the genome is functional in the first place - but I am still looking for research....
-3
votes
0answers
33 views

What is the correlation between sons' IQ and mom's IQ and father's IQ and daughter's IQ? [duplicate]

Has there been any research on that? Do the mother's genes determine the sons' (heredity) intelligence more than the father's? Basically I want to know correlation between IQs between ...
1
vote
1answer
37 views

If someone with “XO” is one of the identical twins with the other twin as male, then what would the sex chromosome of the other twin be?

A more complete question: If someone with sex chromosome of XO is one of the monozygotic twins with the other twin as phenotypically male, then what would the sex chromosome of the other twin be? I ...
-1
votes
0answers
26 views

Probability of horizontal gene transfer in grafted food plants

Last year I tried to graft a few tomato branches on a chili (Capsicum) plant. While it didn't work (the tomato branches died), I collected seeds from a few chili fruits of the same chili plant and ...
0
votes
0answers
25 views

Probabilities in calculating the kinship coefficient

I've been reading up to try to understand how the kinship coefficient (or coefficient of coancestry) is calculated. https://brainder.org/2015/06/13/genetic-resemblance-between-relatives/ this is the ...
28
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...
-1
votes
2answers
101 views

How could the genocide of native Americans have happened? [closed]

According to work from Broden et al. (2015), the variation in the human immune system is largely driven by non-heritable influences. If there is little heritibility how can the genocide of native ...
-2
votes
1answer
77 views

In Genetic Engineering, why are we limited to existing creatures when it comes to creating a new species?

So, I don't know much about Biology. Haven't studied it since high school. So please excuse me if my science isn't proper. I'll do my best. Let's say for example you wanted to make a fire breathing ...
1
vote
1answer
72 views

How does new species come into existence?

The only reason for the creation of new species that I found from the internet is geographical isolation. Are there any more reasons?
0
votes
1answer
79 views

Whether de novo mutation can be inherited or not?

Think about the following scenario: A child is diagnosed as having long QT syndrome, an autosomal dominant disease. However, neither of his parents is affected. This may be due to a new mutation in ...
0
votes
2answers
86 views

Can the apparent drop in insect population be explained by local insects evolving to avoid traps?

In this widely reported Plos One article, it is stated that, after roughly 3 decades of placing Malaise traps in a set of predetermined locations (counting and replacing them regularly), a sharp ...
0
votes
0answers
47 views

Research on chicken that cannot feel pain

In was having a conversation about the ethics of vegetarianism, and if it is right to cause pain to other animals. It is then that I stumbled upon the question, that if, just the way chicken and many ...
0
votes
0answers
28 views

Why does polyploidy occur during failure of cytokinesis and not during failure of karyokinesis?

Polyploidy is increase by a whole set of chormosomes, Cytokinesis is the process of splitting the cell cytoplasm and polyploidy is the splitting of the nuclear mass. Now I ask why polyploidy occurs ...
0
votes
0answers
39 views

Will a less favorable allele's frequency go to 0?

For example, a pond is dark in color. There are two alleles. The dark color allele is dominant over the light color one. Let's assume that the relative fitness of both the homozygous dominant and ...
1
vote
1answer
33 views

How does the age of a parent affect the chances of occurrence of certain genetically transmitted diseases?

Do genetically transmitted age-related diseases (like hypertension, arthritis etc.)have the probability of occurring at an earlier(younger) age in the offspring if they are born at a later age to ...
4
votes
1answer
200 views

What are an internal and external exons?

I read the book: Essential Genetics and Genomics It has a table summarizing the properties of the "typical" human gene: It has a gene feature Size of internal exon,...
0
votes
0answers
10 views

How quickly does recombination shuffle chromosomes?

For each pair of homologous chromosomes, one was inherited from the father and one from the mother. If there were no recombination in meiosis, one could then say that one of the chromosomes was ...
2
votes
1answer
71 views

Understanding ancestry testing mathematically

Forgive me if this question has been asked here before, because it is something which should be very easy to find, but I can't seem to find an answer no matter where I search. The question is simply ...
1
vote
0answers
29 views

Are there “old” neuron types in the neocortex?

"Old" may mean a neuron type that appeared early in the tree of life, and it may mean – going together – that it comes early in the lineage tree of neuronal cells, rooted in the fertilized ...
-2
votes
1answer
54 views

Is genetic equivalence a universal truism or are there exceptions?

Someone who I have been discussing scientific topics for some time came around to the notion that, on a biological level, the seed of a plant is not the same organism as the mature stage of the plant. ...
1
vote
0answers
51 views

What is the developmental and health outcome of an XY individual with an SRY addition on their X chromosome?

I know that "XX male" syndrome occurs through various means, including the addition of an SRY gene in one of the X chromosomes. The developmental and health outcomes of such individuals can be ...
0
votes
0answers
21 views

Do haplotypes have a role to play in the aggression of a human?

there are a couple research papers that connect haplotypes and aggressiveness in canines. Our genes, for example the MAOA gene in the X-chromosome, have also been shown to affect aggression. But can ...
-3
votes
1answer
51 views

Why don't retroviruses kill more?

A retrovirus produces thousands of copies in days. If there are 10e12 cells in the body then it will infect all in four days. It would kill all animals in a few days after that. Why don't ...
1
vote
1answer
49 views

How does an antisense RNA molecule restore protein function in CF patients?

I am researching a treatment for cystic fibrosis (CF) called Eluforsen and I am trying to understand the mechanism by which an RNA molecule can restore proper protein function. In many research ...
3
votes
1answer
45 views

Breeder's equation and equivalent expressions for narrow-sense heritability

I am trying to model the phenotype of a trait as $X = G + E$, where $G$ and $E$ are the genetic and environmental effects. (I'll ignore the distinction between broad-sense and narrow-sense ...
2
votes
0answers
57 views

What is the charge of (bacterial) ribosome?

Ribosomes are negatively charged and thus electrostaticaly repelled from DNA. However, I could not find a good reference that would allow me to estimate the magnitude of negative charge on a ribosome. ...
1
vote
0answers
31 views

Expected $\mu$ and $\sigma^2$ for a phenotypic trait, given heritability h and known parental phenotypic measures?

Say a measurable phenotypic trait has mean $\mu =0$, variance $\sigma^2 = 1$, and heritability $h$, meaning that h*100% of the variation in the population is caused by genetic variation and (1-h)*100% ...
0
votes
0answers
51 views

What is the probability that a gamete will only contain father's chromosomes

As it is depicted in most textbooks, cross-over does not occur between the two "outer" sister chromatids. By independent assortment during Meiosis I, there is 1/2^23 chance that all father's ...
0
votes
1answer
32 views

Could Cyanobacteria farms help dilute pollutants in the atmosphere

If I understand correctly, roughly ~2.8 billion years ago cyanobacteria started pumping large amounts of oxygen into the atmosphere. Using modern industrial processes could this be emulated by ...
0
votes
1answer
126 views

Does natural selection still increase biological complexity?

I recently read The Selfish Gene by Richard Dawkins, which I found very interesting. In one of the last chapters, he gives multiple possible explanations to the question "Why did natural selection ...

1
2 3 4 5
42