Questions tagged [genetics]

Genetics is the branch of biology that deals with the transmission and variation of inherited characteristics.

Filter by
Sorted by
Tagged with
0
votes
0answers
11 views

Why is cognitive maturity related to organism lifespan in larger animals and mammals?

I am not a student of biology, so I should provide some context to me asking this rudimentary question. While doing a graduate-level course on Reinforcement Learning, the instructors focused on how we ...
0
votes
1answer
15 views

About genomic imprinting

In the context of genomic imprinting, how does a human cell "know" whether a chromosome is paternal or maternal(out of a homologous pair), in order to silence genes?
0
votes
0answers
11 views

BLAST, using Smith-Waterman in the last step and S-score

In my bioinformatics course we studied the BLAST agorithm. After finding the HSP's and joining the HSPs together that are close enough and in a correct diagonal trend, we perform a next step: namely a ...
0
votes
0answers
18 views

What does this mean?

The phenotypic ratio of dihybrid cross 9:3:3:1 can be derived as a combination series 3 yellow: 1 green, with 3 round :1 wrinkled. This derivation can be writtenbas follows: (3 round :1 wrinkled) (...
-3
votes
0answers
22 views

For this question would d be correct

Which of the following best describes a gene? A A single DNA molecule wound around proteins B. One leg of a pair of blue denim pants C an allele that exists in 2 or more forms D a sequence of DNA ...
0
votes
1answer
40 views

What animal classes has also “Like Humans” XY Chromosomes for Males and XX for Females?

Are other mammals. birds, reptiles, or even insects same to humans in that the male organisms have XY Chromoson at the end and female XX? Thanks for the ansver
-2
votes
1answer
53 views

Can amount of gene share in descendants be easily calculated?

I saw on the web an explanation on how to calculate amount of certain genes in a person. For instance: if your grandfather was French and your granny was an American then your father is 50 French and ...
-2
votes
0answers
52 views

How do you rationalize the statement “Evolution works like a tinkerer, not an engineer”? [closed]

"Evolution works like a tinkerer, not an engineer": Evolution is defined as change in the heritable characteristics of biological populations over successive generations. This means that it is not the ...
1
vote
1answer
20 views

Can mutation take place in G1 and G2 phases during the cell cycle?

We know that the DNA replicates during the S phase in Interphase. There it might undergo a number of mutations. We also know that the forward half strands are more susceptible to undergoing a mutation ...
3
votes
2answers
2k views

Advantages of pain sensation?

The hazards of congenital insensitivity to pain (CIP) are well-known. This question is about the obverse: what selective advantage, if any, does the normal sensation of pain confer? I'm thinking of ...
1
vote
1answer
374 views

What is neutral genetic differentiation?

What is neutral genetic differentiation? Presumably it's a measure of the distance between organisms in terms of their genetics, but what does 'neutral' refer to?
0
votes
1answer
49 views

Is “Cloning” exact or almost similar to parent?

I was studying "Reproduction in Organism" as an interest of my own and there was a line offspring produced through single parent are exact copies of their parent. Also, they are genetically ...
4
votes
1answer
185 views

What is cognate miRNA?

I understand what miRNA are, but I'm unsure of what cognate means. Looking at this post, it seems that a cognate miRNA is a known miRNA vs. a recently discovered/possible miRNA. Is this thinking on ...
1
vote
1answer
25 views

Why the major gene model can be supported by finding de novo mutations in affected cases?

I found a sentence which I can't fully understand in a publication on the genetics of autism. The unified major gene model is supported by the significant increase in damaging de novo mutations ...
1
vote
1answer
21 views

Analysis of post transplantation lineage tags

I'm having some trouble understanding some bits of a study, mostly about the Sleeping Beauty system and TARIS model, from this paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4408613/ I ...
2
votes
1answer
84 views

Technical term for a mutation that only occurs after a preceding one

Consider a hypothetical population of 1000 organisms. (a) 300 of these 1000 have a T to G substitution at a specific position 1. (b) 200 of these 1000 have an A to T substitution at a second ...
2
votes
1answer
54 views

Are there any proteins assembled from non-adjacent parts of the genome?

Many proteins are assembled from multiple exons with the introns between adjacent exons being spliced out. But are there any proteins that have unrelated to them exons in the middle of their sequence? ...
-4
votes
0answers
15 views

temporary vaccine manufacturing [duplicate]

during the CoVID-19 pandemic and other previous pandemics, why didn't scientist engineered bacteria to form the part of ACE-2 (this specific part without producing the whole enzyme) that is targeted ...
-1
votes
0answers
10 views

Is it possible for unexpected traits to show up in an organism created by gene splicing?

I was trying to learn how accurate some of the statements made about genetics in the Jurassic Park series are. In one movie, they create a "hybrid" dinosaur with "gene splicing"; they combine ...
0
votes
2answers
40 views

Exact definition of single nucleotide polymorphism (SNP)

So, I know on a higher level what an SNP is but I'm a bit confused about the details. Firstly, our professor said that an SNP has to have at least a prevalence of 1% in the general population to be ...
0
votes
2answers
33 views

Exact definition of homoplasy?

I am a poor mathematician looking into the Sars-Cov-2 genome. Is there a proper definition of the word homoplasy? Is it just mutations that happened independently or does there have to be indications ...
1
vote
0answers
19 views

What causes the overactivity of keratin production and expression in the cells of the nail bed/ nail matrix after some traumata?

What is the cellular mechanism of traumatic(sterile) onychodystrophy(hypertrophy)? I.e one hits his toenail and has it removed twice( once after the first trauma and then again 3 years after the first ...
0
votes
0answers
12 views

Tips on sexing of a pet Green Anole? (Besides length)

So I'm looking into lizard breeding (Mainly Leopard Geckos and Anoles) I catch wild ones and also buy them around, but some of them are very close in size and length. I have some males that I know ...
4
votes
2answers
176 views

GULO only for mammals?

I am not a biology student, but just want to know if GULO gene are present only in mammals or all species possess it ? And is GULO gene active in human fetus?
1
vote
1answer
57 views

Balancing selection vs introgression?

Balancing selection can maintain polymorphisms in natural populations for extended periods of evolutionary time. However, in this paper, Dannemann et al. 2016 identify three archaic haplotypes in the ...
0
votes
1answer
27 views

RFLP Pedigree question

A relatively frequent, completely penetrant recessive disease variety of mutations in the gene. The gene has been recently cloned. Analysis of the region flanking the gene reveals that the population ...
0
votes
1answer
37 views

Gene APOA2 SNP rs5082 alleles are A or G, but papers describe it with CC and TT?

rs5082 is a SNP in the APOA2 gene. It is associated with obesity and heart disease risk. According to this article the alleles can be A or G https://www.ncbi.nlm.nih.gov/snp/rs5082#frequency_tab Why ...
2
votes
4answers
55 views

Can the activity of a specific gene in a cell artficially be increased?

While there are many gene regulation mechanisms from the cell itself, I was wondering whether it is possible to increase the gene activity in a living cell permanently (so that the protein that it ...
0
votes
1answer
104 views

Fertilization of the human egg- where does our centrosome come from?

Is there a centrosome in a human egg cell? Is the reason why the egg cell remains paused before meiosis 2 because there isn't a centrosome, and it only divides when the sperm fertilizes it thus it can ...
1
vote
1answer
71 views

Has lamarckism been discredited? [duplicate]

Lamarckism is a pre-darwinian theory according to which an organism's traits acquired to adapt to the environment are passed onto its offspring. A couple of years ago, I attended an event with Richard ...
0
votes
2answers
88 views

Evolution of hunting behavior of parasitoid wasps

Wasps in the genus Pepsis lay their eggs in a specific region on a species of tarantula and their larvae eat the tarantula organs in a specific sequence to keep it alive as long as possible. How ...
0
votes
1answer
65 views

x-linked recessive inheritance and correlation for males

I was inspired by a discussion in this thread. Wikipedia lists a number of disorders linked to recessive genes on the x-chromosome. One typical example is red-green color blindness. Now wikipedia says ...
-1
votes
2answers
57 views

Possibility a child could genetically be also the child of its grandparent

When two people have sex, it is my understanding their diploid set of chromosomes is randomly split in half to create two haploid sets which unify into the diploid chromosome set of the child. For ...
1
vote
1answer
75 views

Questions regarding serial passage of virus through animals arising from the paper The proximal origin of SARS-CoV-2

In this answer on bioinformatics.stackexchange.com to the question inquiring about the validity of the paper Kristian G. Andersen et al, The proximal origin of SARS-CoV-2, the author asserts the ...
1
vote
1answer
44 views

Why/How do Cyanobacteria Produce Toxins?

I've been doing some research on the versatility of nitrogen-fixing cyanobacteria, particularly of the genus Anabaena, and I often run into safety hazards and have to add extra steps to my procedures ...
0
votes
0answers
19 views

Term for a phenotype “restricted to a few cells”

Is there a term for a phenotype that is defined or restricted to a single cell/a few cells/a small patch of tissue? As opposed to defined by the whole organism. Eg. morphology of macrophages (...
2
votes
3answers
86 views

Vectors for genetic engineering

Well can a bacterium be used as a vector?I have learnt that Agrobacterium tumifacian can be used to deliver a gene of interest in plant cells but on a book in a multiple choice question it says that ...
2
votes
0answers
16 views

ABO allele frequencies: Why use the EM algorithm?

In textbooks and lecture notes and slides posted online, determining allele frequencies using blood type information (ABO), under the assumption of Hardy-Weinberg equilibrium, is accomplished using ...
1
vote
0answers
19 views

How does DNA shape a living organism? [closed]

I'm haven't studied biology so excuse me if I'm getting something wrong. I'm trying to understand how the DNA from a sperm and egg cause the egg too multiply and form a perticular shape (shape of a ...
3
votes
1answer
234 views

True examples of common variation due to Mendelian Inheritance

Classic examples of mendelian inheritance are genetic diseases such as sickle-cell anemia, Tay-Sachs, cystic fibrosis, and xeroderma pigmentosa. For some of these diseases, it is believed that they ...
0
votes
1answer
37 views

Are the alleles that code for the same phenotype all the same exact sequence?

The idea that you can be homozygous for a gene means that there are limited options or alleles , correct ? My question is, if the mom has the allele b which codes for a blue eye, and the dad has an ...
0
votes
2answers
2k views

Barr body Giemsa staining

Not all the female cheek cells show Barr Bodies when stained with Giemsa stain? Only 30 to 40% female cells show Barr Bodies. Why? Our Experiment: We washed mouth twice with listerine to reduce ...
-1
votes
1answer
40 views

Best fundamental literature about genetics [closed]

I'm seeking for good genetics literature. I'm not afraid of it's complexity, because I want to have relevant knowledges about molecular genetics. After Wikipedia articles and basic molecular-biology ...
-1
votes
1answer
63 views

Why is sickle cell trait expressed in half of all cells rather than all cells containing half-sickled haemoglobin

If sickle cell trait is due to be heterozygous with respect to a single gene mutation on the haemoglobin β-globin chain, why is it the case that ~50% of RBCs are sickled rather than half of the ...
0
votes
0answers
35 views

Modeling the production of mRNA

I have the following example of how an equation for the production of mRNA in a particular organism could look like: Consider the following equation for the production of mRNA for a gene Y. Gene Y ...
3
votes
1answer
95 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
1
vote
1answer
481 views

What is this bizarre in-growth in this red bell pepper?

I just chanced upon a rather strange red bell pepper (or capsicum?): The green formation is bulbous to touch, just the like the outside of the bellpepper, and it has the same smell as one. I'm no ...
8
votes
1answer
744 views

Genetic expression in interspecific hybrids

Referring to interspecific hybrids, I have the following two questions:- Quoting from wikipedia:- The offspring of an interspecific cross are very often sterile; thus, hybrid sterility prevents ...
2
votes
1answer
1k views

Understanding DNA supercoiling

While trying to understand DNA supercoiling, I came across these lines in the book Genetics by Ursula Goodenough : All natural DNA is superhelical. The axis of the duplex itself follows a helical ...
2
votes
2answers
77 views

What is the substance that tumors release that stimulates growth of blood vessels but suppresses its release from other tumors?

I'm currently in high school and I am working on a cancer research project. My project consists of a cancer, and different ways to treat it. I have a set of benign tumor and I was thinking of ...

1
2 3 4 5
42