Questions tagged [genetics]

Genetics is the branch of biology that deals with the transmission and variation of inherited characteristics.

Filter by
Sorted by
Tagged with
0
votes
1answer
49 views

What animal classes has also “Like Humans” XY Chromosomes for Males and XX for Females? [closed]

Are other mammals. birds, reptiles, or even insects same to humans in that the male organisms have XY Chromoson at the end and female XX? Thanks for the ansver
1
vote
1answer
48 views

Can mutation take place in G1 and G2 phases during the cell cycle?

We know that the DNA replicates during the S phase in Interphase. There it might undergo a number of mutations. We also know that the forward half strands are more susceptible to undergoing a mutation ...
0
votes
1answer
65 views

Is “Cloning” exact or almost similar to parent?

I was studying "Reproduction in Organism" as an interest of my own and there was a line offspring produced through single parent are exact copies of their parent. Also, they are genetically ...
1
vote
1answer
29 views

Why the major gene model can be supported by finding de novo mutations in affected cases?

I found a sentence which I can't fully understand in a publication on the genetics of autism. The unified major gene model is supported by the significant increase in damaging de novo mutations ...
2
votes
1answer
64 views

Are there any proteins assembled from non-adjacent parts of the genome?

Many proteins are assembled from multiple exons with the introns between adjacent exons being spliced out. But are there any proteins that have unrelated to them exons in the middle of their sequence? ...
1
vote
2answers
43 views

Exact definition of homoplasy?

I am a poor mathematician looking into the Sars-Cov-2 genome. Is there a proper definition of the word homoplasy? Is it just mutations that happened independently or does there have to be indications ...
2
votes
1answer
89 views

Technical term for a mutation that only occurs after a preceding one

Consider a hypothetical population of 1000 organisms. (a) 300 of these 1000 have a T to G substitution at a specific position 1. (b) 200 of these 1000 have an A to T substitution at a second ...
0
votes
2answers
48 views

Exact definition of single nucleotide polymorphism (SNP)

So, I know on a higher level what an SNP is but I'm a bit confused about the details. Firstly, our professor said that an SNP has to have at least a prevalence of 1% in the general population to be ...
0
votes
0answers
13 views

Tips on sexing of a pet Green Anole? (Besides length)

So I'm looking into lizard breeding (Mainly Leopard Geckos and Anoles) I catch wild ones and also buy them around, but some of them are very close in size and length. I have some males that I know ...
2
votes
4answers
66 views

Can the activity of a specific gene in a cell artficially be increased?

While there are many gene regulation mechanisms from the cell itself, I was wondering whether it is possible to increase the gene activity in a living cell permanently (so that the protein that it ...
-1
votes
2answers
62 views

Possibility a child could genetically be also the child of its grandparent

When two people have sex, it is my understanding their diploid set of chromosomes is randomly split in half to create two haploid sets which unify into the diploid chromosome set of the child. For ...
1
vote
1answer
89 views

Questions regarding serial passage of virus through animals arising from the paper The proximal origin of SARS-CoV-2

In this answer on bioinformatics.stackexchange.com to the question inquiring about the validity of the paper Kristian G. Andersen et al, The proximal origin of SARS-CoV-2, the author asserts the ...
0
votes
0answers
21 views

Term for a phenotype “restricted to a few cells”

Is there a term for a phenotype that is defined or restricted to a single cell/a few cells/a small patch of tissue? As opposed to defined by the whole organism. Eg. morphology of macrophages (...
4
votes
0answers
33 views

ABO allele frequencies: Why use the EM algorithm?

In textbooks and lecture notes and slides posted online, determining allele frequencies using blood type information (ABO), under the assumption of Hardy-Weinberg equilibrium, is accomplished using ...
2
votes
3answers
122 views

Vectors for genetic engineering

Well can a bacterium be used as a vector?I have learnt that Agrobacterium tumifacian can be used to deliver a gene of interest in plant cells but on a book in a multiple choice question it says that ...
1
vote
0answers
23 views

How does DNA shape a living organism? [closed]

I'm haven't studied biology so excuse me if I'm getting something wrong. I'm trying to understand how the DNA from a sperm and egg cause the egg too multiply and form a perticular shape (shape of a ...
0
votes
1answer
39 views

Are the alleles that code for the same phenotype all the same exact sequence?

The idea that you can be homozygous for a gene means that there are limited options or alleles , correct ? My question is, if the mom has the allele b which codes for a blue eye, and the dad has an ...
-1
votes
1answer
42 views

Best fundamental literature about genetics [closed]

I'm seeking for good genetics literature. I'm not afraid of it's complexity, because I want to have relevant knowledges about molecular genetics. After Wikipedia articles and basic molecular-biology ...
0
votes
0answers
35 views

Modeling the production of mRNA

I have the following example of how an equation for the production of mRNA in a particular organism could look like: Consider the following equation for the production of mRNA for a gene Y. Gene Y ...
0
votes
1answer
34 views

RFLP Pedigree question

A relatively frequent, completely penetrant recessive disease variety of mutations in the gene. The gene has been recently cloned. Analysis of the region flanking the gene reveals that the population ...
2
votes
1answer
96 views

Pedigree - Dealing With Unknown Parent Genotypes

I'm dealing with a pedigree problem, and I'm having some trouble dealing with problems of unknown parental genotypes (where there are multiple possibilities). This is not a homework question; it's an ...
1
vote
0answers
43 views

How much can you improve performance by selective breeding?

How much can you improve performance by selective breeding? I am curious of all kinds of performance, physical as well as cognitive, but I guess the latter is harder to answer so to make the question ...
3
votes
1answer
108 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
1
vote
1answer
89 views

Has lamarckism been discredited? [duplicate]

Lamarckism is a pre-darwinian theory according to which an organism's traits acquired to adapt to the environment are passed onto its offspring. A couple of years ago, I attended an event with Richard ...
4
votes
1answer
80 views

Why/How do Cyanobacteria Produce Toxins?

I've been doing some research on the versatility of nitrogen-fixing cyanobacteria, particularly of the genus Anabaena, and I often run into safety hazards and have to add extra steps to my procedures ...
1
vote
0answers
21 views

What causes the overactivity of keratin production and expression in the cells of the nail bed/ nail matrix after some traumata?

What is the cellular mechanism of traumatic(sterile) onychodystrophy(hypertrophy)? I.e one hits his toenail and has it removed twice( once after the first trauma and then again 3 years after the first ...
2
votes
1answer
75 views

CRISPR-Cas9 knockout

With CRISPR-Cas9 I have conducted a targeted knockout of a DNA region encoding a certain protein (working with leukocytes). My question is, how long does it take until this protein is not detectable ...
-1
votes
1answer
61 views

Large study showing that attraction to only the same sex has to do with your genes, published where?

Can someone please help me out and find and link me the study from a couple of years ago that showed how only same sex attraction, when the male cant become attracted to a woman, it has to do with ...
4
votes
1answer
97 views

What gene targets associated with the new coronavirus (SARS-CoV-2) have been identified so far?

One hypothesis for which we have some supporting evidence is that the new virus (SARS-CoV-2) "enters human cells through an interaction with angiotensin-converting enzyme 2" see here. Although it is ...
1
vote
0answers
17 views

How exactly does DNA polymerase III detect a mismatched base?

How exactly does DNA polymerase III detect a mismatched base? I know how it removes it, via exonuclease activity, but how does it 'detect' it molecularly in the first place?
-1
votes
1answer
71 views

Is it true that if a human lived long enough (up to 3-400 years), he/she would eventually develop cancer?

I have just studied DNA, but I am not so clear. So, I would like you to explain it more clearly. This is what I think when a human grow older and older, his or her DNA repair mechanism would be ...
96
votes
3answers
16k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
9
votes
1answer
109 views

What causes cells to inactivate one X-chromosome?

Normally, when a cell has two X-chromosomes (female genome), one is randomly inactivated. How does the cell detect that there are two X-chromosomes in the first place? Is there some kind of protein ...
1
vote
0answers
24 views

Breakdown of functional human genome by organ/What fraction of the functional human genome is devoted specifically to brain functioning?

Of course, there won't be a precise known answer to the question, as it is not even known precisely what percentage of the genome is functional in the first place - but I am still looking for research....
1
vote
1answer
47 views

If someone with “XO” is one of the identical twins with the other twin as male, then what would the sex chromosome of the other twin be?

A more complete question: If someone with sex chromosome of XO is one of the monozygotic twins with the other twin as phenotypically male, then what would the sex chromosome of the other twin be? I ...
1
vote
0answers
36 views

Probabilities in calculating the kinship coefficient

I've been reading up to try to understand how the kinship coefficient (or coefficient of coancestry) is calculated. https://brainder.org/2015/06/13/genetic-resemblance-between-relatives/ this is the ...
28
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...
-2
votes
1answer
83 views

In Genetic Engineering, why are we limited to existing creatures when it comes to creating a new species?

So, I don't know much about Biology. Haven't studied it since high school. So please excuse me if my science isn't proper. I'll do my best. Let's say for example you wanted to make a fire breathing ...
1
vote
1answer
77 views

How does new species come into existence?

The only reason for the creation of new species that I found from the internet is geographical isolation. Are there any more reasons?
0
votes
1answer
89 views

Whether de novo mutation can be inherited or not?

Think about the following scenario: A child is diagnosed as having long QT syndrome, an autosomal dominant disease. However, neither of his parents is affected. This may be due to a new mutation in ...
0
votes
2answers
93 views

Can the apparent drop in insect population be explained by local insects evolving to avoid traps?

In this widely reported Plos One article, it is stated that, after roughly 3 decades of placing Malaise traps in a set of predetermined locations (counting and replacing them regularly), a sharp ...
0
votes
0answers
49 views

Research on chicken that cannot feel pain

In was having a conversation about the ethics of vegetarianism, and if it is right to cause pain to other animals. It is then that I stumbled upon the question, that if, just the way chicken and many ...
0
votes
0answers
52 views

Will a less favorable allele's frequency go to 0?

For example, a pond is dark in color. There are two alleles. The dark color allele is dominant over the light color one. Let's assume that the relative fitness of both the homozygous dominant and ...
1
vote
1answer
46 views

How does the age of a parent affect the chances of occurrence of certain genetically transmitted diseases?

Do genetically transmitted age-related diseases (like hypertension, arthritis etc.)have the probability of occurring at an earlier(younger) age in the offspring if they are born at a later age to ...
4
votes
1answer
280 views

What are an internal and external exons?

I read the book: Essential Genetics and Genomics It has a table summarizing the properties of the "typical" human gene: It has a gene feature Size of internal exon,...
3
votes
2answers
122 views

Understanding ancestry testing mathematically

Forgive me if this question has been asked here before, because it is something which should be very easy to find, but I can't seem to find an answer no matter where I search. The question is simply ...
1
vote
0answers
33 views

Are there “old” neuron types in the neocortex?

"Old" may mean a neuron type that appeared early in the tree of life, and it may mean – going together – that it comes early in the lineage tree of neuronal cells, rooted in the fertilized ...
-2
votes
1answer
55 views

Is genetic equivalence a universal truism or are there exceptions?

Someone who I have been discussing scientific topics for some time came around to the notion that, on a biological level, the seed of a plant is not the same organism as the mature stage of the plant. ...
1
vote
0answers
58 views

What is the developmental and health outcome of an XY individual with an SRY addition on their X chromosome?

I know that "XX male" syndrome occurs through various means, including the addition of an SRY gene in one of the X chromosomes. The developmental and health outcomes of such individuals can be ...
1
vote
1answer
60 views

How does an antisense RNA molecule restore protein function in CF patients?

I am researching a treatment for cystic fibrosis (CF) called Eluforsen and I am trying to understand the mechanism by which an RNA molecule can restore proper protein function. In many research ...

1 2 3
4
5
45