Skip to main content

Questions tagged [pcr]

Polymerase Chain Reaction is a method of replicating DNA exponentially from even a single molecule.

Filter by
Sorted by
Tagged with
0 votes
0 answers
59 views

taqman probes to measure telomere length

Has anyone previously used the TaqMan probe 5'-FAM-AGGGTTAGGGTTAGGGTTA-MGB-NFQ-3' (or something similar in terms of targeting TTAGGG), which targets the telomere repeat sequence (TTAGGG), to estimate ...
haz's user avatar
  • 33
-2 votes
0 answers
20 views

What could be the components of the ddPCR mix here, and what is the meaning of VIC FAM HEX?

Can someone please explain me the procedure shown in this diagram?
Rio's user avatar
  • 1
1 vote
1 answer
36 views

What is the minimum Ct value that you would consider indicates no gene expression?

I am doing relative quantification to compare gene expression between a control with several mutant backgrounds using qPCR. Looking online I find several different sources suggesting different values ...
aquaporin's user avatar
  • 188
0 votes
0 answers
74 views

Qpcr negative efficiency

Hello Stack Exchange Biology world, I have struggled with my qPRC results for over 5 months. I have a bunch of DNA samples, and I want to find the quantity of Pseudomonas syringae contained. My issue ...
KGee's user avatar
  • 139
0 votes
0 answers
5 views

Identification of Secondary metabolites gene clusters in fungi

I am trying to identify secondary metabolites gene clusters specifically PKS from endophytes through PCR then sanger sequencing. Are there set of specific primers available or do I have to design my ...
Colyn's user avatar
  • 1
0 votes
1 answer
28 views

PCR: Are primers designed to be complementary to a DNA sequence within the template DNA or to the 3' ends of the template DNA?

I was told that in order to produce primers, the DNA sequences at the 3' end of the template strand must be known, and that these primers are complementary to 3' ends of the template DNA. However, ...
Bernkastel's user avatar
0 votes
0 answers
3 views

Given an F, R pair of SSR primers of 20 bp, which is the active portion of each

I'm a math & physics person with a general understanding of PCR. For my question, consider this F, R pair of SSR primers: TTGTCCGTTTCTTATACAAT TCTTTTTAGGCAGATGTTAG It is my understanding that if ...
Hermitian's user avatar
0 votes
1 answer
56 views

Can contaminants in the DNA extract disturb the sequencing?

I'm having troubles with some DNA extractions. The yields are much lower than expected, and the Nanodrop spectrophotometer is showing quite a bit of contamination through the 260/230 ratios (see table ...
Joel's user avatar
  • 61
0 votes
0 answers
18 views

Is there a way to isolate bacteria from a bacteria/phage plaque in order to PCR bacteria only?

I am writing a paper for a class that involves a mock grant proposal. I am looking at an experiment which requires sequencing of host DNA from a virus/host model, and am having a hard time finding a ...
Erin Marble's user avatar
0 votes
0 answers
39 views

Sequencing a PCR product with no band

I did a PCR that successfully showed the appropriate bands one time, but when I tried to re-do the same PCR just at a larger quantity to send for Sanger sequencing, very faint or no bands were seen. ...
Nalonda's user avatar
0 votes
1 answer
960 views

Qpcr Copy number formula

I recently started to get involved with quantitative PCR. I have some data and I want to calculate the copy number of them. In the output Excel file, I have the following cells (I am running ...
KGee's user avatar
  • 139
0 votes
0 answers
10 views

qPCR from tissue to compare T-cell subpopulations

In the experiment, groups of mice have been intranasally immunised with different vaccine formulations. We have stored nasal tissue (basically, the front part of the skull without muscles, brain, etc.)...
alex's user avatar
  • 1
1 vote
1 answer
63 views

How to compare basal expression of a gene in two tissues using qPCR techniques?

I have two tissues and they are not treated; I would like just to compare the basal level of expression of the gene of interest (goi) in these two types of tissue (tissue1 and tissue2). After qPCR, I ...
Lara's user avatar
  • 23
0 votes
0 answers
22 views

How to quantify basic levels of samples in qPCR?

I do have to quantify the difference in basic levels of expression for a given gene in two types of tissues. There is no treatment, just basic levels. Before I had a "control" sample that I ...
Lara's user avatar
  • 23
1 vote
1 answer
57 views

modify PCR steps to include a ligation

Imagine a multiplex PCR in which after the extension step, the dsDNA is nicked and requires a ligation reaction to repair the nick before the next denaturation step. So the steps would be: Denature ...
Ryan's user avatar
  • 121
0 votes
1 answer
93 views

What should be considered a GC clamp in a qPCR primer?

Hello there! After reading different sources regarding designing of qPCR primers, I'm a little confused regarding the concept of GC clamp. Can you help me by telling which of these cases below is ...
H001O's user avatar
  • 1
0 votes
1 answer
57 views

Explanation of QPCR's "mixing curves."

I just started using qPCR (learning the logic and the basics, actually). I am trying to create a standard curve for ecoli and Pseudomonas syringae. I started by making some DNA dilutions of 10%, 1%, 0,...
KGee's user avatar
  • 139
0 votes
0 answers
41 views

PCR primer design for specific region

I want to amplify a specific region of my genome. I want the segment to be as precise as possible but the primers that would align to the start and end of the target fragment are not optimal in terms ...
Homap's user avatar
  • 103
1 vote
0 answers
30 views

Testing primer for misspriming in 770 Mb lepidopteran genome

I designed primer pairs for a lepidopteran genome (Cydia pomonella, codling moth, ~770 Mb, ~60% transposable elements, Reference Genome Paper). I have around 60 primer pairs that bind to a specific ...
CoDa's user avatar
  • 103
0 votes
1 answer
148 views

Why do the components of PCR mixture need to be added in a specific order?

I have recently been told that the components of a PCR mixture need to be added in a specific order: primers, dNTP, and finally polymerase. May I know why this is the case?
Oakss's user avatar
  • 13
2 votes
1 answer
48 views

Linearising plasmids for CRISPR experiment

I am currently designing a mock CRISPR knock-out experiment, and I’m wanting to insert a plasmid for selection. Using a restriction enzyme at 2750bp for cutting, would the location of the cut site ...
cyaandye's user avatar
1 vote
1 answer
52 views

TMPRSS2 Primer Design

I am trying to design a primer for TMPRSS2 PCR reaction. However, this gene is in reverse position like in the picture I'll show. From the nucleotide sequence I got from NCBI, should I reverse the ...
Hieronimus Adiyoga's user avatar
1 vote
0 answers
21 views

Would a size-specific, electrophoresis-based RNA quantification kit work for ssDNA as well?

I'm using a custom library of ssDNA oligos to test the performance of some qPCR assays with mismatched bases in various primer and probe regions, and I'm trying to come up with a good way to verify ...
MikeyC's user avatar
  • 4,734
2 votes
1 answer
281 views

How to avoid mutations when performing Gibson Assembly (or generating amplicons during PCR)

More often than desired (about 75 % of the time), when building plasmids via Gibson Assembly (~ 5 kb plasmids; from a maximum of 2 fragments) we obtain clones with several random point mutations all ...
The Quark's user avatar
  • 213
1 vote
1 answer
1k views

Primers spaning exon-exon junctions

I am trying to choose which of two primers is most appropriate to use in qPCR, based on if the primer spans an exon-exon junction or not, where the primer that does span an exon-exon junction is ...
katara 's user avatar
  • 131
4 votes
1 answer
401 views

What is the function of PCR in the whole genome sequencing?

Whole genome sequencing (WGS) method is using PCR in one of their steps. In the following page from the CDC, we find this diagram: It says that the PCR is needed to "make copies of each DNA"...
discipulus's user avatar
0 votes
0 answers
31 views

PCR: From transgene/microgram to cell concentration

I am doing research on CAR T-cell kinetics. The measurement of CAR T-cell concentrations across time is normally carried out with qPCR (see here, Fig. 1). These concentrations are generally reported ...
amr95's user avatar
  • 1
1 vote
1 answer
71 views

PCR for gene expression [closed]

Could somebody please explain the basic principle behind how qPCR can detect if a gene is expressed or not? I tried looking at literature on ScienceDirect and other websites but I could not find any ...
thetrueembodimentofstupidity's user avatar
0 votes
1 answer
92 views

How do you do Polymerase Chain Reaction (PCR) if you don't have a thermal cycler?

PCR has three steps: Denaturation, Annealing, and Primer extension. Let's say you do not have a thermal cycler in the lab, how would you mimic similar conditions and perform PCR?
user71072's user avatar
5 votes
1 answer
184 views

Why does plasmid cloning efficiency go down with increased size of insert?

I am setting up a cloning experiment. Briefly, I ran PCR on a gene of interest, cloned it into a vector (pGemTeasy) and bulked it up in bacteria. I have been advised to limit the size of my fragment ...
Olaf's user avatar
  • 300
0 votes
0 answers
35 views

Biology (DNA electrophoresis with agarose)X

I'm researching a polymorphism using restriction fragment length polymorphism (RFLP) and gel electrophoresis. After RFLP, I should see fragments at 141bp and 111bp, but I can not see in 2% agarose, ...
seyed farhad sadr tabatabaie's user avatar
2 votes
1 answer
32 views

How precise does a 1:1 ratio PCR sample mixture (microliters) have to be for the liquid amount ratio to not have any effect on results

Amount of liquid: 5 micro liters master mix 5 micro liters of patient sample
Nicole's user avatar
  • 21
4 votes
2 answers
488 views

Do 0.2 vs 0.5 ml epitubes require different PCR machines, incubators, etc?

Eppendorf themselves and many other companies list on their website two above mentioned sizes of "PCR tubes". As I understand 0.2 ml is by far more widespread and "standard" for ...
beardeadclown's user avatar
1 vote
1 answer
52 views

How are PCR tests for detecting COVID-19 performed on hamsters?

This is something I've been wondering about ever since the stories of people finding hamsters with a COVID infection in Hong Kong. Apparently those animals were tested using a PCR test, but I'm ...
Nzall's user avatar
  • 368
2 votes
1 answer
95 views

qPCR - different results total RNA vs mRNA

I have performed qPCR on a tissue, where I have extracted total RNA and also purified mRNA. I ran the qPCR samples together, and have therefore been exposed to the same conditions except the ...
F.Sal's user avatar
  • 53
0 votes
1 answer
254 views

How many non-pairing bases can a PCR primer have in directed mutagenesis?

I'm not including a lot of details here, because the problem I'm working with is actually more complex. Say you have the DNA sequence 5'-...tct gcg gtg gtt ggc att ctg ctg...-3' Could this sequence ...
Quantonium's user avatar
1 vote
1 answer
61 views

Is there any methods to avoid the pcr control contamination?

Why do I use the primers in the D1-D2 region to amplify the fungus, and using water as a negative control has a weak band that is the same size as the target fragment? When using the ITS primer, using ...
yuanzheng xu's user avatar
1 vote
1 answer
282 views

Transformation and PCR in molecular cloning

After obtaining the recombinant DNA, it is common to transform into E. coli to screen for recombinant DNA and amplify it. But I would like to ask can we amplify it using PCR? I think there will be 3 ...
Questions's user avatar
  • 371
1 vote
0 answers
66 views

In what sense is PCR a "nuclear-derived" technique? [closed]

The International Atomic Energy Agency (IAEA) has launched an initiative, ZODIAC, to combat pandemics that originate in animals. In part, this involves the deployment of kits utilising real-time ...
user924308's user avatar
-3 votes
1 answer
71 views

Why don't we use hybridization instead of PCR? [closed]

So, I would like to ask, why don't we use just DNA hybridization instead of PCR primer amplification to diagnise some illness? I know, when you have a really small amount of DNA from virus or cell you ...
Laboka's user avatar
  • 15
0 votes
0 answers
116 views

Lowering annealing temperature in PCR

In the book "Lewin's Genes" there is the following quote: Lowering the Tm of a PCR reaction—in effect, relaxing the reaction stringency and allowing primers to anneal to not quite perfect ...
JhyG's user avatar
  • 1
0 votes
2 answers
137 views

How did we do the COVID PCR after its first appear?

I recently learned about the PCR testing and its idea of using primers to replicate the DNA or RNA. By this I assume that we need to know the sequencing of the DNA to make our primers. If that is true;...
Faisal's user avatar
  • 31
2 votes
1 answer
191 views

Using PCR to add the overhangs to gBlocks for NEB HiFi

Does adding the overhangs to gBlocks for NEB Hifi using PCR pose a big problem? The IDT website suggests that one should design the gBlocks with the overhangs. However, if I did not do this, will it ...
Confused Student's user avatar
0 votes
0 answers
99 views

The average of Ct values in real-time PCR

The Ct value is the number of cycles when the "PCR amplification curve with the horizontal axis as the number of cycles" and the "predetermined threshold" intersect, and is not ...
Blue Various's user avatar
3 votes
1 answer
87 views

Polymerase Cycle Assembly (PCA) is not working (Only primrs in EF Gel)

Helllo All 👋! I am working trying to assemble dsDNA fragments (for further golden gate domestication) via polymerase cycle assembly (PCA). After designing the required oligonucleotides with overlap ...
fmjorge99's user avatar
4 votes
0 answers
101 views

Unknown Issue with qPCR Standard

I am currently doing the ground work for a SELEX experiment and I am attempting to verify my standards for the starting library. I ran a reaction with samples containing 50, 5, 0.5, and 0.05ng of my ...
Christopher Belica's user avatar
1 vote
0 answers
52 views

What are the causes of gene amplification in archaea?

I was studying this article about Genome Sequencing of a Genetically Tractable Pyrococcus furiosus Strain Reveals a Highly Dynamic Genome in order to try to extrapolate some features that could ...
Manuela's user avatar
  • 443
1 vote
1 answer
373 views

Detection of primer dimer on RT-PCR?

I usually do RT-PCR test for covid-19. Curves for Patients and Positive CTRL mostly appeared at 20 to 25 Ct. Sometimes, there are some curves that emerge at the last 5 cycles. Some argue that they are ...
Arash Salehi's user avatar
1 vote
2 answers
71 views

Why there is Cp/Ct (crossing point) value for negative sample in COVID-19 RT-PCR?

I am from IT/ Engineering background and have some confusion in RT-PCR. So far my understanding we extract RNA from test specimens and transcribed it into complementary DNA (cDNA), and inside PCR DNA ...
alex3465's user avatar
  • 113
6 votes
2 answers
97 views

Which method of gene amplification for toehold switches?

My team and I are from a high school and are planning to carry out some research investigating some toehold switch riboregulators which we have designed in silico. However, we have little experience ...
Peter Heywood's user avatar

1
2 3 4 5
7