Questions tagged [rna]

RNA, or ribonucleic acid, is a biological macromolecule made of nucleotides used in cells to convey genetic information to protein. RNA also plays a role in catalyzing certain biological reactions as well as carrying genetic material in some viruses.

Filter by
Sorted by
Tagged with
0
votes
0answers
43 views

Which domains or motifs are capable of attaching to both DNA and RNA?

Domains or motifs of transcription factors are catalytically active to attach to the nucleic acid of any type. Where could I find a list of domains or motifs which are able to attach to both DNA and ...
2
votes
1answer
44 views

Does Remdesivir cause bone marrow suppression?

According to Wikipedia, Remdesivir is a prodrug of GS-441524 which is a nucleoside analog. I know that nucleotides are the building blocks of both DNA and RNA, meaning nucleotide analogues that ...
0
votes
1answer
29 views

What is the purpose of an siRNA screen in drug discovery?

In the paper "A genome-wide siRNA screen identifies a druggable host pathway essential for the Ebola virus life cycle" by Martin et al. the authors try to disrupt the Ebola life-cycle by ...
5
votes
1answer
74 views

Were nicotinic acid/amide or flavin nucleotides ever part of primary RNA sequence?

NADH and FADH2 redox reactions are built deep into our biochemistry. For example, pyridine nucleotides are involved in >500 enzymatic reactions. When we look at the structure of deamido-NAD+, it ...
4
votes
1answer
107 views

Introns and miRNA

From this paper, it is stated that some introns may contain genes coding for miRNA, miRNA is essential in regulating gene expression by pairing with RNA, hence disrupting regular translation. From ...
7
votes
1answer
143 views

Why can't certain nucleoside analogs be used to label bacterial RNA?

A 2020 publication in Nucleic Acids Research 1 includes the following passage: A variety of nucleoside analogs have been developed for metabolic RNA labeling in various eukaryotic cells (9–16). Among ...
-2
votes
1answer
55 views

Are there ribozymes that cut double strands

the header already says: Are there any ribozymes known that cut double strands? A kind of ribozyme equivalent to the Ribonuclease III. With cut, I mean that the backbone of both strands, forming the ...
1
vote
2answers
122 views

Why do genes, encoding the same proteins and in the same conditions, have different expression?

Is it possible that two genes, which come from two different cell cultures and which encodes the same protein, produces different quantity of mRNA? If yes, why? My question comes from the fact that I ...
0
votes
1answer
80 views

With an mRNA-vaccine, would it hypothetically be possible to get that sequence transcribed into their genome for people who suffer from a retrovirus?

I recently read a bit about the mRNA-vaccines for COVID-2019. I fully understand that mRNA cannot enter the genome of a healthy person as they lack the required reverse transcriptase required to ...
5
votes
2answers
729 views

Is viral single-stranded RNA in the absence of reverse transcriptase infectious?

In a medical microbiology textbook I'm reading (Murray et al, 1994), the authors state the following: The retrovirus genome has a 5' cap and is polyadenylated at the 3' end. Although the genome ...
1
vote
1answer
155 views

Does N1-methyl-pseudouridine occur naturally in any RNA?

Pseudouridine occurs naturally in some RNAs. But what about the methylated variant of it, N1-methyl-pseudouridine? The latter is a key ingredient in both the Pfizer and Moderna Covid-19 vaccines, ...
0
votes
0answers
25 views

Stability of RNA including Thymine nucleobase

Does an RNA double strand containing the nucleobase T instead of U has a lower free energy? Or more precisely: There are tabulated values for the change in free energy of the canonical neighboring ...
1
vote
0answers
43 views

How does RNA polymerase II CTD bind to the RNA modification proteins if the tail is flexible?

The tail of RNA polymerase II is flexible, not folded into a fixed structure , but does each repeat have more "rigid" structure (i.e. fold into a structure that has less rotation freedom ...
1
vote
1answer
102 views

Do RNA modification proteins bind to specific repeats on the RNA polymerase II CTD?

The C-terminal domain (CTD) of human RNA polymerase II has 52 repeats of a similar heptapeptide sequence. Will the RNA modification proteins only bind to some repeats at specific locations on this (e....
-2
votes
2answers
51 views

Destroying RNA of viruses using Ribonuclease

I wonder if it is possible to design some Ribonuclease to destroy only specific RNAs (like those of viruses). Then, if virus tries to infect, his RNA will be cut. Or, instead of creating Ribonuclease, ...
0
votes
0answers
37 views

How did Rna replicate according to Rna World Hypothesis?

I was studying Rna World Hypothesis in Khan Academy, and there is a line..... The RNA world hypothesis suggests that life on Earth began with a simple RNA molecule that could copy itself without help ...
1
vote
0answers
60 views

RNA vaccination and Autoimmune Reactions

To my knowledge we do not have any robust experience with RNA vaccination. Most likely this will change in the near future as RNA vaccines against COVID are in the pipeline. The rationale behind this ...
12
votes
2answers
861 views

Does double stranded RNA (dsRNA) exist in eukaryotic cells?

I know it sounds like a stupid question. Obviously, tRNAs and rRNAs, for example, form loops and could therefore be considered as dsRNAs... but are they really considered as such? Are there examples ...
0
votes
0answers
18 views

What prevents the translation of the negative strand of negative-sense viral genomic RNA?

Some RNA viruses contain negative-sense RNA. Then they use this negative-sense RNA to make positive-sense RNA that is then translated into protein. My question is what prevents the translational ...
1
vote
0answers
14 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
1
vote
0answers
14 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
1
vote
1answer
65 views

Do DNA viroids exist?

Viroids are described as short circular ssRNA with no protein coating. Are there any analogous infectious particles that contain DNA instead of RNA? If DNA viroids do not exist, is there an obvious ...
-1
votes
1answer
39 views

Why are some parts of an rRNA structure diagram not labelled?

I've been looking at this structure diagram of the 16S rRNA and have been wondering why some parts of the diagrams have labelled base pairs while other parts are just lines and dots. I'm new to this ...
0
votes
1answer
57 views

What is the role of pyrophosphatase in RNA polymerization?

In Molecular Cell Biology (8th edition) there's a fragment in chapter 5.2 that says: The energetics of the polymerization reaction strongly favor the addition of ribonucleotides to the growing RNA ...
0
votes
2answers
98 views

VPg priming of the replication of RNA viruses

I'm doing a presentation on the replication of SARS-CoV-2 for my chemistry class, and I found that to replicate its RNA, the virus uses RNA-dependent RNA polymerase, which is primed by a VPg primer. ...
-1
votes
1answer
91 views

Why does the structure of RNA change? [closed]

RNA only has one strand, but like DNA, is made up of nucleotides. RNA strands are shorter than DNA strands. RNA sometimes forms a secondary double helix structure, but only intermittently. Why does ...
1
vote
0answers
50 views

Why all negative ssRNA viruses have helical capsids?

You can always say it's a coincidence, but is there particular need to have a helical capsid? Do they need their RNA to be more protected than +ssRNA? Is it better for RdRp attachment? This paper ...
2
votes
1answer
75 views

Why is an intron (or exon) still called intron (exon) if retained in (excluded from) mRNA?

In most explanations, the sections of RNA removed during splicing are called introns, and the remaining segments that are stitched together are called exons. That is, introns and exons are defined in ...
4
votes
0answers
29 views

Why can oligo-U not be used to isolate mRNAs, instead of oligo dT?

dTTP oligonucleotides are used to isolate mRNAs because mRNAs (in eukaryotes) have a poly A tail which binds to the complementary oligo-dT. However, why can we not use oligo-U instead (uracil)? I ...
-1
votes
2answers
62 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
3
votes
1answer
119 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
0
votes
1answer
40 views

Does the Abbott ID NOW coronavirus test return a positive result if you take it while you're still in the incubation period? [closed]

It seems like Abbott's ID Now test works by detecting the virus directly as opposed to checking for antibodies? If the test result is negative does that mean you don't have the virus? Or does that not ...
2
votes
1answer
49 views

Roughly speaking how stable are short sections of single-stranded RNA in exposed environments compared to double-stranded DNA?

A search following a recent news item led me to a CDC Morbidity and Mortality Weekly Report for 23 March 2020 which says in part: SARS-CoV-2 RNA was identified on a variety of surfaces in cabins ...
15
votes
1answer
9k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
1
vote
1answer
100 views

Expression of eukaryotic ribosomal DNA

The Wikipedia page for rDNA says "Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA" Also, the figure next to it says "The gene segment of eukaryotic rDNA contains 18S, 5.8S, and 28S ...
0
votes
1answer
66 views

A question about dna triplex

Short DNA triplex strands have been identified in various organsims. But, would injecting a single strand of DNA or RNA (with its bases complementary to the bases of DNA found in the major groove of a ...
1
vote
1answer
22 views

what happens to rna length if we have a termination site in additional to the original one [closed]

if we have an RNA transcription and we add an additonal temination site in the middle , will i have two RNA molecules or just a short one ?
0
votes
1answer
87 views

How to design the primer when you don't have GC?

I have treated my RNA with sodium bisulfite so all my cytosine is converted into thymine. Then I used that RNA for my RT reaction. I have a cDNA template without Cs. Now I am trying to amplify that ...
2
votes
1answer
31 views

I added ethanol to my TRizol RNA extraction

I added ethanol instead of chloroform to the cell suspension in Trizol. Can I still obtain my aqueous phase?
2
votes
0answers
59 views

Detect differentially expressing cells

I have data (RNA expression values, obtained with in situ hybridization) collected from 1mio human cells. For each cell, I have the expression value of a negative control (non-human RNA) and single-...
1
vote
1answer
31 views

What percentage of RNA splicing happens during transcription?

Splicing can happen either during transcription, or directly afterwards. I am reading about single-cell RNA seq, and according to this paper, they observed that 15–25% of reads contained unspliced ...
3
votes
1answer
99 views

The shape of mRNA

I was wondering about the shapes assumed by mRNA. I have read some sources quoting that it is linear (quora, so not very reliable) and also a source that says a hairpin shape is common (nature, so I ...
0
votes
4answers
222 views

Why do mutations not take place in mRNA of higher eukaryotes?

Is it because it is too short-lived to be mutated? Both DNA and RNA are nucleic acids so how is mRNA protected? RNA viruses undergo mutations to evolve so I guess it is not immune to mutations
0
votes
1answer
56 views

Where can I obtain the sequence of the E. coli ribosomal RNA precursor?

I have found separate sequences for 16S rRNA (from the small subunit) and 23S rRNA and 5S rRNA (from the large subunit). I need the full precursor rRNA sequence, which I cannot find. However the ...
0
votes
2answers
79 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
2
votes
1answer
58 views

Non-nucleated cell-like population with RNA

We're working on invertebrate hemolymph (blood) and we have found with flow cytometry (staining with DRAQ5) a cell-like population without nucleus but it has RNA production. Does anyone any ...
1
vote
1answer
120 views

What is the difference between DNA vs RNA Editing in the context of gene therapy?

As a someone with beginner knowledge on biology, I have come across the terms "RNA editing". Take this paper for example : RNA Editing with CRISPR-Cas13 From my understanding, DNA -> RNA -> Proteins ...
0
votes
0answers
42 views

Which database has the ready made 16S rRNA Multiple Sequence Alignment File that I can download directly from?

In my case, I need the ready made 16S rRNA Multiple Sequence Alignment File for E.coli and use it to generate the phylogenetic tree file in Newick format. I've tried using the one from utexas website, ...
1
vote
0answers
41 views

How to map the N6-dimethyladenosine by primer extension?

I am trying to map N6-dimethyladenosine on rRNA using primer extension (low dNTPs assay) method. But i am not able to detect map my position. I went through some articles they mentioned like they ...
0
votes
0answers
47 views

How to detect specific mRNA dsRNA by Northern analysis?

I silenced a gene by RNAi method, for that i chose the gene and the size of the gene is 1.5kb and my insert size is 500nts. i did the transfection and i want to confirm the silencing by northern ...

1
2 3 4 5
7