Questions tagged [rna]

RNA, or ribonucleic acid, is a biological macromolecule made of nucleotides used in cells to convey genetic information to protein. RNA also plays a role in catalyzing certain biological reactions as well as carrying genetic material in some viruses.

Filter by
Sorted by
Tagged with
0 votes
1 answer
26 views

Can the coding strand for an RNA act as the template for another?

Can the same strand of DNA act as a sense strand and an antisense strand at two different occasions of transcription and result in two different proteins?
user avatar
0 votes
0 answers
31 views

Is Zayed et al.’s revision of Orthornavirae robust?

Zayed et al. (April 7, 2022) in Science “Cryptic and abundant marine viruses at the evolutionary origins of Earth’s RNA virome” report several major hitherto-unknown Ribovirial phyla: The two most ...
user avatar
0 votes
1 answer
56 views

Confusion regarding the meaning of the coding strand of DNA [duplicate]

I am having problems getting the ‘correct’ answer for the above question. I am assuming that mRNA uses the template strand (not the coding strand) for protein synthesis. So: ...
user avatar
  • 11
3 votes
1 answer
86 views

Zayed et al. (2022) "Cryptic and abundant marine viruses at the evolutionary origins of Earth’s RNA virome"; expressed sequences or transcribed?

Phys.org's Ocean water samples yield treasure trove of RNA virus data summarizes Zayed et al. (April 7, 2022) in Science Cryptic and abundant marine viruses at the evolutionary origins of Earth’s RNA ...
user avatar
  • 4,961
3 votes
1 answer
89 views

Difference between LIGR-seq and PARIS methods

I would like to reuse a dataset produced by LIGR-seq for ncRNA secondary structure prediction in the style of PARIS method. At ...
user avatar
22 votes
2 answers
4k views

Is it possible to make a vaccine against cancer?

If we can make RNA vaccines against COVID-19 and we know which errors in our DNA leads to different kinds of cancer, can we make a vaccine that will teach our immune system to detect and destroy ...
user avatar
  • 339
1 vote
0 answers
52 views

In what sense is PCR a "nuclear-derived" technique? [closed]

The International Atomic Energy Agency (IAEA) has launched an initiative, ZODIAC, to combat pandemics that originate in animals. In part, this involves the deployment of kits utilising real-time ...
user avatar
0 votes
4 answers
225 views

How do mRNA vaccines work with respect to presentation of the antigen?

As I understand it, mRNA vaccines operate by taking a gene for some distinctive feature of the target virus and arranging for the cells of the vaccine recipient to manufacture the proteins that make ...
user avatar
0 votes
0 answers
55 views

How is RNA content distributed in daughter cells during cell division?

During cell division, DNA becomes equally distributed between the daughter cells. But how is RNA content distributed in the daughter cells?
user avatar
3 votes
1 answer
125 views

Does ribonuclease processing of pre-crRNAs happen co-transcriptionally?

I understand CRISPR-mediated bacterial immunity to occur in the following simplified steps: A CRISPR array is transcribed from promoters in the leader sequence to yield a precursor CRISPR RNA (pre-...
user avatar
  • 7,224
1 vote
1 answer
48 views

Where in the cell does this enhancer RNA knockdown take place?

In Pneuli et al 2015, they knock down an enhancer RNA using RNAi, testing whether it is a mere byproduct or whether it has a key role in the enhancer's function. They find their system works: the ...
user avatar
0 votes
1 answer
77 views

Can Covid's RNA be nullified by an opposite RNA strand?

Firstly, I have scant knowledge of biology, epidemiology, virology, and related fields. If my question seems nonsensical or bewildering, I beg your pardon. I'm not sure how to phrase this, but I'll ...
user avatar
  • 109
1 vote
1 answer
39 views

What determines the nucleotides incorporated into RNA by polynucleotide phosphorylase?

Polynucleotide phosphorylase, in addition to its role as an exonuclease, is also involved in the post-transcriptional addition of nucleotides to RNA in a template-independent manner: “Polynucleotide ...
user avatar
2 votes
1 answer
88 views

Does Remdesivir cause bone marrow suppression?

According to Wikipedia, Remdesivir is a prodrug of GS-441524 which is a nucleoside analog. I know that nucleotides are the building blocks of both DNA and RNA, meaning nucleotide analogues that ...
user avatar
  • 121
0 votes
1 answer
31 views

What is the purpose of an siRNA screen in drug discovery?

In the paper "A genome-wide siRNA screen identifies a druggable host pathway essential for the Ebola virus life cycle" by Martin et al. the authors try to disrupt the Ebola life-cycle by ...
user avatar
  • 543
5 votes
1 answer
83 views

Were nicotinic acid/amide or flavin nucleotides ever part of primary RNA sequence?

NADH and FADH2 redox reactions are built deep into our biochemistry. For example, pyridine nucleotides are involved in >500 enzymatic reactions. When we look at the structure of deamido-NAD+, it ...
user avatar
  • 2,343
4 votes
1 answer
119 views

Introns and miRNA

From this paper, it is stated that some introns may contain genes coding for miRNA, miRNA is essential in regulating gene expression by pairing with RNA, hence disrupting regular translation. From ...
user avatar
  • 343
7 votes
1 answer
180 views

Why can't certain nucleoside analogs be used to label bacterial RNA?

A 2020 publication in Nucleic Acids Research 1 includes the following passage: A variety of nucleoside analogs have been developed for metabolic RNA labeling in various eukaryotic cells (9–16). Among ...
user avatar
  • 7,224
-2 votes
1 answer
57 views

Are there ribozymes that cut double strands

the header already says: Are there any ribozymes known that cut double strands? A kind of ribozyme equivalent to the Ribonuclease III. With cut, I mean that the backbone of both strands, forming the ...
user avatar
1 vote
2 answers
128 views

Why do genes, encoding the same proteins and in the same conditions, have different expression?

Is it possible that two genes, which come from two different cell cultures and which encodes the same protein, produces different quantity of mRNA? If yes, why? My question comes from the fact that I ...
user avatar
  • 423
3 votes
1 answer
368 views

With an mRNA-vaccine, would it hypothetically be possible to get that sequence transcribed into their genome for people who suffer from a retrovirus?

I recently read a bit about the mRNA-vaccines for COVID-2019. I fully understand that mRNA cannot enter the genome of a healthy person as they lack the required reverse transcriptase to transcribe RNA ...
user avatar
  • 147
5 votes
2 answers
764 views

Is viral single-stranded RNA in the absence of reverse transcriptase infectious?

In a medical microbiology textbook I'm reading (Murray et al, 1994), the authors state the following: The retrovirus genome has a 5' cap and is polyadenylated at the 3' end. Although the genome ...
user avatar
  • 177
4 votes
2 answers
291 views

Does N1-methyl-pseudouridine occur naturally in any RNA?

Pseudouridine occurs naturally in some RNAs. But what about the methylated variant of it, N1-methyl-pseudouridine? The latter is a key ingredient in both the Pfizer and Moderna Covid-19 vaccines, ...
user avatar
  • 3,022
0 votes
0 answers
25 views

Stability of RNA including Thymine nucleobase

Does an RNA double strand containing the nucleobase T instead of U has a lower free energy? Or more precisely: There are tabulated values for the change in free energy of the canonical neighboring ...
user avatar
1 vote
0 answers
48 views

How does RNA polymerase II CTD bind to the RNA modification proteins if the tail is flexible?

The tail of RNA polymerase II is flexible, not folded into a fixed structure , but does each repeat have more "rigid" structure (i.e. fold into a structure that has less rotation freedom ...
user avatar
  • 181
1 vote
1 answer
123 views

Do RNA modification proteins bind to specific repeats on the RNA polymerase II CTD?

The C-terminal domain (CTD) of human RNA polymerase II has 52 repeats of a similar heptapeptide sequence. Will the RNA modification proteins only bind to some repeats at specific locations on this (e....
user avatar
  • 181
-2 votes
2 answers
52 views

Destroying RNA of viruses using Ribonuclease

I wonder if it is possible to design some Ribonuclease to destroy only specific RNAs (like those of viruses). Then, if virus tries to infect, his RNA will be cut. Or, instead of creating Ribonuclease, ...
user avatar
  • 1
1 vote
0 answers
63 views

RNA vaccination and Autoimmune Reactions

To my knowledge we do not have any robust experience with RNA vaccination. Most likely this will change in the near future as RNA vaccines against COVID are in the pipeline. The rationale behind this ...
user avatar
12 votes
2 answers
987 views

Does double stranded RNA (dsRNA) exist in eukaryotic cells?

I know it sounds like a stupid question. Obviously, tRNAs and rRNAs, for example, form loops and could therefore be considered as dsRNAs... but are they really considered as such? Are there examples ...
user avatar
  • 684
1 vote
0 answers
15 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
user avatar
1 vote
0 answers
22 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
user avatar
  • 1,260
1 vote
1 answer
73 views

Do DNA viroids exist?

Viroids are described as short circular ssRNA with no protein coating. Are there any analogous infectious particles that contain DNA instead of RNA? If DNA viroids do not exist, is there an obvious ...
user avatar
-1 votes
1 answer
40 views

Why are some parts of an rRNA structure diagram not labelled?

I've been looking at this structure diagram of the 16S rRNA and have been wondering why some parts of the diagrams have labelled base pairs while other parts are just lines and dots. I'm new to this ...
user avatar
  • 925
0 votes
1 answer
110 views

What is the role of pyrophosphatase in RNA polymerization?

In Molecular Cell Biology (8th edition) there's a fragment in chapter 5.2 that says: The energetics of the polymerization reaction strongly favor the addition of ribonucleotides to the growing RNA ...
user avatar
  • 11
0 votes
2 answers
100 views

VPg priming of the replication of RNA viruses

I'm doing a presentation on the replication of SARS-CoV-2 for my chemistry class, and I found that to replicate its RNA, the virus uses RNA-dependent RNA polymerase, which is primed by a VPg primer. ...
user avatar
-1 votes
1 answer
156 views

Why does the structure of RNA change? [closed]

RNA only has one strand, but like DNA, is made up of nucleotides. RNA strands are shorter than DNA strands. RNA sometimes forms a secondary double helix structure, but only intermittently. Why does ...
user avatar
  • 1
1 vote
0 answers
51 views

Why all negative ssRNA viruses have helical capsids?

You can always say it's a coincidence, but is there particular need to have a helical capsid? Do they need their RNA to be more protected than +ssRNA? Is it better for RdRp attachment? This paper ...
user avatar
  • 208
2 votes
1 answer
128 views

Why is an intron (or exon) still called intron (exon) if retained in (excluded from) mRNA?

In most explanations, the sections of RNA removed during splicing are called introns, and the remaining segments that are stitched together are called exons. That is, introns and exons are defined in ...
user avatar
  • 121
7 votes
1 answer
145 views

What are the reasons for using oligo-dT instead of oligo-U to isolate mRNAs?

dTTP oligonucleotides are used to isolate mRNAs because mRNAs (in eukaryotes) have a poly A tail which binds to the complementary oligo-dT. However, why do we not use oligo-U instead (uracil)? I would ...
user avatar
  • 606
0 votes
2 answers
74 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
user avatar
  • 151
4 votes
1 answer
135 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
user avatar
  • 149
0 votes
1 answer
49 views

Does the Abbott ID NOW coronavirus test return a positive result if you take it while you're still in the incubation period? [closed]

It seems like Abbott's ID Now test works by detecting the virus directly as opposed to checking for antibodies? If the test result is negative does that mean you don't have the virus? Or does that not ...
user avatar
  • 1
2 votes
1 answer
51 views

Roughly speaking how stable are short sections of single-stranded RNA in exposed environments compared to double-stranded DNA?

A search following a recent news item led me to a CDC Morbidity and Mortality Weekly Report for 23 March 2020 which says in part: SARS-CoV-2 RNA was identified on a variety of surfaces in cabins ...
user avatar
  • 4,961
16 votes
1 answer
9k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
user avatar
  • 2,747
1 vote
1 answer
117 views

Expression of eukaryotic ribosomal DNA

The Wikipedia page for rDNA says "Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA" Also, the figure next to it says "The gene segment of eukaryotic rDNA contains 18S, 5.8S, and 28S ...
user avatar
  • 257
0 votes
1 answer
73 views

A question about dna triplex

Short DNA triplex strands have been identified in various organsims. But, would injecting a single strand of DNA or RNA (with its bases complementary to the bases of DNA found in the major groove of a ...
user avatar
  • 320
1 vote
1 answer
22 views

what happens to rna length if we have a termination site in additional to the original one [closed]

if we have an RNA transcription and we add an additonal temination site in the middle , will i have two RNA molecules or just a short one ?
user avatar
0 votes
1 answer
95 views

How to design the primer when you don't have GC?

I have treated my RNA with sodium bisulfite so all my cytosine is converted into thymine. Then I used that RNA for my RT reaction. I have a cDNA template without Cs. Now I am trying to amplify that ...
user avatar
2 votes
1 answer
36 views

I added ethanol to my TRizol RNA extraction

I added ethanol instead of chloroform to the cell suspension in Trizol. Can I still obtain my aqueous phase?
user avatar
2 votes
0 answers
60 views

Detect differentially expressing cells

I have data (RNA expression values, obtained with in situ hybridization) collected from 1mio human cells. For each cell, I have the expression value of a negative control (non-human RNA) and single-...
user avatar

1
2 3 4 5
7