Questions tagged [rna]

RNA, or ribonucleic acid, is a biological macromolecule made of nucleotides used in cells to convey genetic information to protein. RNA also plays a role in catalyzing certain biological reactions as well as carrying genetic material in some viruses.

Filter by
Sorted by
Tagged with
1
vote
0answers
45 views

In what sense is PCR a "nuclear-derived" technique? [closed]

The International Atomic Energy Agency (IAEA) has launched an initiative, ZODIAC, to combat pandemics that originate in animals. In part, this involves the deployment of kits utilising real-time ...
0
votes
4answers
154 views

How do mRNA vaccines work with respect to presentation of the antigen?

As I understand it, mRNA vaccines operate by taking a gene for some distinctive feature of the target virus and arranging for the cells of the vaccine recipient to manufacture the proteins that make ...
0
votes
0answers
46 views

How is RNA content distributed in daughter cells during cell division?

During cell division, DNA becomes equally distributed between the daughter cells. But how is RNA content distributed in the daughter cells?
3
votes
0answers
85 views

Does ribonuclease processing of pre-crRNAs happen co-transcriptionally?

I understand CRISPR-mediated bacterial immunity to occur in the following simplified steps: A CRISPR array is transcribed from promoters in the leader sequence to yield a precursor CRISPR RNA (pre-...
1
vote
1answer
43 views

Where in the cell does this enhancer RNA knockdown take place?

In Pneuli et al 2015, they knock down an enhancer RNA using RNAi, testing whether it is a mere byproduct or whether it has a key role in the enhancer's function. They find their system works: the ...
0
votes
1answer
73 views

Can Covid's RNA be nullified by an opposite RNA strand?

Firstly, I have scant knowledge of biology, epidemiology, virology, and related fields. If my question seems nonsensical or bewildering, I beg your pardon. I'm not sure how to phrase this, but I'll ...
1
vote
1answer
39 views

What determines the nucleotides incorporated into RNA by polynucleotide phosphorylase?

Polynucleotide phosphorylase, in addition to its role as an exonuclease, is also involved in the post-transcriptional addition of nucleotides to RNA in a template-independent manner: “Polynucleotide ...
2
votes
1answer
49 views

Does Remdesivir cause bone marrow suppression?

According to Wikipedia, Remdesivir is a prodrug of GS-441524 which is a nucleoside analog. I know that nucleotides are the building blocks of both DNA and RNA, meaning nucleotide analogues that ...
0
votes
1answer
31 views

What is the purpose of an siRNA screen in drug discovery?

In the paper "A genome-wide siRNA screen identifies a druggable host pathway essential for the Ebola virus life cycle" by Martin et al. the authors try to disrupt the Ebola life-cycle by ...
5
votes
1answer
76 views

Were nicotinic acid/amide or flavin nucleotides ever part of primary RNA sequence?

NADH and FADH2 redox reactions are built deep into our biochemistry. For example, pyridine nucleotides are involved in >500 enzymatic reactions. When we look at the structure of deamido-NAD+, it ...
4
votes
1answer
111 views

Introns and miRNA

From this paper, it is stated that some introns may contain genes coding for miRNA, miRNA is essential in regulating gene expression by pairing with RNA, hence disrupting regular translation. From ...
7
votes
1answer
154 views

Why can't certain nucleoside analogs be used to label bacterial RNA?

A 2020 publication in Nucleic Acids Research 1 includes the following passage: A variety of nucleoside analogs have been developed for metabolic RNA labeling in various eukaryotic cells (9–16). Among ...
-2
votes
1answer
57 views

Are there ribozymes that cut double strands

the header already says: Are there any ribozymes known that cut double strands? A kind of ribozyme equivalent to the Ribonuclease III. With cut, I mean that the backbone of both strands, forming the ...
1
vote
2answers
125 views

Why do genes, encoding the same proteins and in the same conditions, have different expression?

Is it possible that two genes, which come from two different cell cultures and which encodes the same protein, produces different quantity of mRNA? If yes, why? My question comes from the fact that I ...
0
votes
1answer
222 views

With an mRNA-vaccine, would it hypothetically be possible to get that sequence transcribed into their genome for people who suffer from a retrovirus?

I recently read a bit about the mRNA-vaccines for COVID-2019. I fully understand that mRNA cannot enter the genome of a healthy person as they lack the required reverse transcriptase required to ...
5
votes
2answers
745 views

Is viral single-stranded RNA in the absence of reverse transcriptase infectious?

In a medical microbiology textbook I'm reading (Murray et al, 1994), the authors state the following: The retrovirus genome has a 5' cap and is polyadenylated at the 3' end. Although the genome ...
1
vote
1answer
233 views

Does N1-methyl-pseudouridine occur naturally in any RNA?

Pseudouridine occurs naturally in some RNAs. But what about the methylated variant of it, N1-methyl-pseudouridine? The latter is a key ingredient in both the Pfizer and Moderna Covid-19 vaccines, ...
0
votes
0answers
25 views

Stability of RNA including Thymine nucleobase

Does an RNA double strand containing the nucleobase T instead of U has a lower free energy? Or more precisely: There are tabulated values for the change in free energy of the canonical neighboring ...
1
vote
0answers
45 views

How does RNA polymerase II CTD bind to the RNA modification proteins if the tail is flexible?

The tail of RNA polymerase II is flexible, not folded into a fixed structure , but does each repeat have more "rigid" structure (i.e. fold into a structure that has less rotation freedom ...
1
vote
1answer
111 views

Do RNA modification proteins bind to specific repeats on the RNA polymerase II CTD?

The C-terminal domain (CTD) of human RNA polymerase II has 52 repeats of a similar heptapeptide sequence. Will the RNA modification proteins only bind to some repeats at specific locations on this (e....
-2
votes
2answers
52 views

Destroying RNA of viruses using Ribonuclease

I wonder if it is possible to design some Ribonuclease to destroy only specific RNAs (like those of viruses). Then, if virus tries to infect, his RNA will be cut. Or, instead of creating Ribonuclease, ...
1
vote
0answers
61 views

RNA vaccination and Autoimmune Reactions

To my knowledge we do not have any robust experience with RNA vaccination. Most likely this will change in the near future as RNA vaccines against COVID are in the pipeline. The rationale behind this ...
12
votes
2answers
916 views

Does double stranded RNA (dsRNA) exist in eukaryotic cells?

I know it sounds like a stupid question. Obviously, tRNAs and rRNAs, for example, form loops and could therefore be considered as dsRNAs... but are they really considered as such? Are there examples ...
1
vote
0answers
14 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
1
vote
0answers
17 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
1
vote
1answer
67 views

Do DNA viroids exist?

Viroids are described as short circular ssRNA with no protein coating. Are there any analogous infectious particles that contain DNA instead of RNA? If DNA viroids do not exist, is there an obvious ...
-1
votes
1answer
39 views

Why are some parts of an rRNA structure diagram not labelled?

I've been looking at this structure diagram of the 16S rRNA and have been wondering why some parts of the diagrams have labelled base pairs while other parts are just lines and dots. I'm new to this ...
0
votes
1answer
73 views

What is the role of pyrophosphatase in RNA polymerization?

In Molecular Cell Biology (8th edition) there's a fragment in chapter 5.2 that says: The energetics of the polymerization reaction strongly favor the addition of ribonucleotides to the growing RNA ...
0
votes
2answers
99 views

VPg priming of the replication of RNA viruses

I'm doing a presentation on the replication of SARS-CoV-2 for my chemistry class, and I found that to replicate its RNA, the virus uses RNA-dependent RNA polymerase, which is primed by a VPg primer. ...
-1
votes
1answer
118 views

Why does the structure of RNA change? [closed]

RNA only has one strand, but like DNA, is made up of nucleotides. RNA strands are shorter than DNA strands. RNA sometimes forms a secondary double helix structure, but only intermittently. Why does ...
1
vote
0answers
51 views

Why all negative ssRNA viruses have helical capsids?

You can always say it's a coincidence, but is there particular need to have a helical capsid? Do they need their RNA to be more protected than +ssRNA? Is it better for RdRp attachment? This paper ...
2
votes
1answer
102 views

Why is an intron (or exon) still called intron (exon) if retained in (excluded from) mRNA?

In most explanations, the sections of RNA removed during splicing are called introns, and the remaining segments that are stitched together are called exons. That is, introns and exons are defined in ...
5
votes
1answer
97 views

Why can oligo-U not be used to isolate mRNAs, instead of oligo dT?

dTTP oligonucleotides are used to isolate mRNAs because mRNAs (in eukaryotes) have a poly A tail which binds to the complementary oligo-dT. However, why can we not use oligo-U instead (uracil)? I ...
-1
votes
2answers
68 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
4
votes
1answer
129 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
0
votes
1answer
45 views

Does the Abbott ID NOW coronavirus test return a positive result if you take it while you're still in the incubation period? [closed]

It seems like Abbott's ID Now test works by detecting the virus directly as opposed to checking for antibodies? If the test result is negative does that mean you don't have the virus? Or does that not ...
2
votes
1answer
49 views

Roughly speaking how stable are short sections of single-stranded RNA in exposed environments compared to double-stranded DNA?

A search following a recent news item led me to a CDC Morbidity and Mortality Weekly Report for 23 March 2020 which says in part: SARS-CoV-2 RNA was identified on a variety of surfaces in cabins ...
15
votes
1answer
9k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
1
vote
1answer
110 views

Expression of eukaryotic ribosomal DNA

The Wikipedia page for rDNA says "Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA" Also, the figure next to it says "The gene segment of eukaryotic rDNA contains 18S, 5.8S, and 28S ...
0
votes
1answer
69 views

A question about dna triplex

Short DNA triplex strands have been identified in various organsims. But, would injecting a single strand of DNA or RNA (with its bases complementary to the bases of DNA found in the major groove of a ...
1
vote
1answer
22 views

what happens to rna length if we have a termination site in additional to the original one [closed]

if we have an RNA transcription and we add an additonal temination site in the middle , will i have two RNA molecules or just a short one ?
0
votes
1answer
89 views

How to design the primer when you don't have GC?

I have treated my RNA with sodium bisulfite so all my cytosine is converted into thymine. Then I used that RNA for my RT reaction. I have a cDNA template without Cs. Now I am trying to amplify that ...
2
votes
1answer
33 views

I added ethanol to my TRizol RNA extraction

I added ethanol instead of chloroform to the cell suspension in Trizol. Can I still obtain my aqueous phase?
2
votes
0answers
60 views

Detect differentially expressing cells

I have data (RNA expression values, obtained with in situ hybridization) collected from 1mio human cells. For each cell, I have the expression value of a negative control (non-human RNA) and single-...
1
vote
1answer
33 views

What percentage of RNA splicing happens during transcription?

Splicing can happen either during transcription, or directly afterwards. I am reading about single-cell RNA seq, and according to this paper, they observed that 15–25% of reads contained unspliced ...
3
votes
1answer
110 views

The shape of mRNA

I was wondering about the shapes assumed by mRNA. I have read some sources quoting that it is linear (quora, so not very reliable) and also a source that says a hairpin shape is common (nature, so I ...
0
votes
4answers
253 views

Why do mutations not take place in mRNA of higher eukaryotes?

Is it because it is too short-lived to be mutated? Both DNA and RNA are nucleic acids so how is mRNA protected? RNA viruses undergo mutations to evolve so I guess it is not immune to mutations
0
votes
1answer
58 views

Where can I obtain the sequence of the E. coli ribosomal RNA precursor?

I have found separate sequences for 16S rRNA (from the small subunit) and 23S rRNA and 5S rRNA (from the large subunit). I need the full precursor rRNA sequence, which I cannot find. However the ...
0
votes
2answers
101 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
2
votes
1answer
60 views

Non-nucleated cell-like population with RNA

We're working on invertebrate hemolymph (blood) and we have found with flow cytometry (staining with DRAQ5) a cell-like population without nucleus but it has RNA production. Does anyone any ...

1
2 3 4 5
7