Questions tagged [rna-sequencing]

Determining the sequence of RNA. This technique is used for discovery and quantification of mRNAs and ncRNAs.

Filter by
Sorted by
Tagged with
3 votes
1 answer
89 views

Difference between LIGR-seq and PARIS methods

I would like to reuse a dataset produced by LIGR-seq for ncRNA secondary structure prediction in the style of PARIS method. At ...
user avatar
0 votes
0 answers
66 views

RNA-Seq: Is it conventional to use a threshold RPKM value to determine if a gene of interest is expressed in a sample?

I am interested in finding out at what stages of development a gene of interest is expressed in the human brain. I am using the Developmental Transcriptome tool from the Allen Brain Atlas to find this ...
user avatar
  • 1,545
2 votes
0 answers
44 views

Is there a reference brain sample for the RNA-Seq data in the Developmental Transcriptome tool from the Allen Brain Atlas?

I am using the Developmental Transcriptome tool from the Allen Brain Atlas to determine at what stages of development a specific gene is expressed in the human brain. I have read the official ...
user avatar
  • 1,545
1 vote
1 answer
140 views

What is the difference between 4th generation sequencing and NGS?

The generation of sequencing technologies has come on leaps and bounds and there are stark differences between the types of technology used. There is a great Q&A here What is the difference ...
user avatar
  • 11.2k
1 vote
1 answer
85 views

RNA sequencing and taxonomic analysis of gut microbiome

I've been searching for methods of RNA sequencing, and I always find that the step of rRNA removal is emphasized. However, in my research, I need to analyze both functional and taxonomic data from the ...
user avatar
0 votes
0 answers
24 views

Apply Shannon-Weiner index to evaluate single-cell sample balance?

I would like to identify single-cell clusters where each sample is evenly represented in it. Is it OK to calculate the Shannon-Weiner index from the sample counting data of each cluster? I am worrying ...
user avatar
  • 1
2 votes
1 answer
61 views

What is the best method to check for differential gene expression in large dataset? I want to identify aging differentially expressed genes

My data is RNAseq data and I want to know which all genes (which I am looking for) are differentially expressed with age. I have tried the Kruskal-Wallis test and fold change methods. Do you have any ...
user avatar
1 vote
0 answers
15 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
user avatar
1 vote
0 answers
22 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
user avatar
  • 1,260
-1 votes
1 answer
30 views

What is multiplet nuclei capture rate?

I met this terminology in a publication.https://core.ac.uk/download/pdf/226940818.pdf. It's in the last sentence of the second paragraph in the text. I tried to search for it but didn't get a ...
user avatar
7 votes
1 answer
145 views

What are the reasons for using oligo-dT instead of oligo-U to isolate mRNAs?

dTTP oligonucleotides are used to isolate mRNAs because mRNAs (in eukaryotes) have a poly A tail which binds to the complementary oligo-dT. However, why do we not use oligo-U instead (uracil)? I would ...
user avatar
  • 606
4 votes
1 answer
134 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
user avatar
  • 149
1 vote
1 answer
123 views

Confusion about read counts distribution in RNA-seq

While reading old DESeq paper (Anders and Huber 2010) I came across following line. If reads were independently sampled from a population with given, fixed fractions of genes, the read counts ...
user avatar
  • 2,386
-1 votes
1 answer
47 views

Where to find a list of genes coding for protein in human

I have raw read counts extracted by htseq from STAR alignment I have both data with both Ensembl IDs and gene symbols, but I need only a latest list of protein coding genes in human; I googled but I ...
user avatar
  • 103
2 votes
0 answers
36 views

What does the final (Illumina) RNA-seq library contain? ss cdNA or ds cDNA?

I guess the oligos on Illumina's flow cell only hybridize to to single-stranded cDNAs (sscDNA). However, when I read the TruSeq protocol (googled: TruSeq® RNASample Preparation v2 Guide) at the PCR ...
user avatar
  • 131
0 votes
2 answers
112 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
user avatar
  • 133
0 votes
1 answer
50 views

How to do desalt reaction by passage through a Micro Bio-spin 6 column?

I want to perform the bisulfite sequencing on rRNA to detect the 5-mC. I followed this protocol • DNA-free™ DNA Removal Kit (Invitrogen) • Purified RNA, Treat RNA according to manufacturer's ...
user avatar
0 votes
1 answer
79 views

Can Cas13 be used with multiple crRNAs in the same reaction?

CRISPR-Cas13 equipped with crRNA (complementary to transcripts of interest) can be designed to target ssRNA transcripts in cells. Upon successful crRNA and ssRNA binding, a fluorescent domain on ...
user avatar
  • 389
1 vote
0 answers
42 views

How to map the N6-dimethyladenosine by primer extension?

I am trying to map N6-dimethyladenosine on rRNA using primer extension (low dNTPs assay) method. But i am not able to detect map my position. I went through some articles they mentioned like they ...
user avatar
0 votes
1 answer
54 views

Is there a data base, tool or method I can use to find out which of my genes code for cytokine receptors?

I have a list of over 600 differentially expressed genes from my single cell RNA seq data analyses. I want to proceed to find out which of my genes code for cytokine receptors so that I can show on a ...
user avatar
  • 111
0 votes
0 answers
39 views

Why do the RNAseq reads map to only a certain region of a viral genome?

I am looking at RNAseq data and mapping them to 3 RNA segments from Cucumber Mosaic Virus. I trimmed the adapters from the fastq files and converted them to fasta, which I searched against a virus ...
user avatar
0 votes
2 answers
66 views

identification of differentially expressed genes in RNA-seq analysis [closed]

I am using four different packages (viz. EBSeq, DESeq2, edgeR, LPEseq) for identification of differential genes. Now I am confused whose fold change value should I take for further downstream ...
user avatar
4 votes
5 answers
1k views

Why analyse transcriptome instead of proteome?

Analysing the transcriptome (RNA-Seq, microarrays, qPCR etc) is probably the most widely used technology to assess gene expression and dynamic cellular processes. The results are then extrapolated (...
user avatar
1 vote
0 answers
21 views

How many samples to run an association study on B-Cell receptors

We are trying to find biomarkers on the B-Cell receptor VDJ regions. To do this we plan to run Single cell RNA-Seq (using the solution from 10x genomics https://www.10xgenomics.com/solutions/vdj/) to ...
user avatar
2 votes
1 answer
30 views

Metatranscriptomics Extraction

I am attempting to perform metatranscriptomics analysis of a cleanroom. The DNA input is known to be rather low (<1pg). Despite this, I want to still attempt to try it. I am thinking it might be ...
user avatar
  • 123
1 vote
1 answer
74 views

If a person is infected with an RNA virus what percentage of the RNA in the blood of the person contains RNA of the virus?

Karius uses DNA sequencing of everything that's contained in a sample to detect all bacteria and DNA-viruses in the sample. Given the way that costs of sequencing are falling this approach seems to be ...
user avatar
  • 2,494
-2 votes
2 answers
75 views

Correct structure of RNA [closed]

Of the 2 figures, which is the correct structure of RNA, This is the link : 1: https://i.stack.imgur.com/IYgyv.jpg Sorry, the figure is not to scale. If there's any problem with the question ...
user avatar
  • 137
2 votes
0 answers
87 views

RNA contains Uracil in place of Thymine [duplicate]

Thymine does not present in RNA but DNA containing thymine why
user avatar
0 votes
1 answer
27 views

dbSNP clarification

I am currently going through this paper - link. In their methods section the authors have described they have used dbSNP for checking biallelic expression of genes. I would like to know if dbSNP ...
user avatar
1 vote
0 answers
60 views

Should I use glycogen in isopropanol to precipitate RNA or does glycogen have harmful consequences on downstream protocols such as RNA seq?

I have heard that one can use glycogen in isopropanol to better visualise the RNA pellet after centrifugation. What are the advantages and disadvantages of adding glycogen in isopropanol for RNA ...
user avatar
1 vote
1 answer
283 views

Should I use RNAseZAP on my bench and pipettes before RNA extraction?

Should I spray RNAseZAP on my bench and pipettes before working with RNA? I am regularly using RNase at my bench and would like to work with RNA as well. Could traces of RNase on my equipment degrade ...
user avatar
1 vote
1 answer
147 views

Where is DNA during the process of RNA extraction using Trisure?

Where is DNA during the process of RNA extraction using Trisure described here? Given that DNA is also a nucleic acid, should I expect the isolated RNA to also contain DNA? However, Bioline claims RNA ...
user avatar
1 vote
0 answers
267 views

Is DNase treatment necessary before RNA sequencing?

Is it necessary to treat total RNA with DNase before sequencing it? In particular, if the library prep relies on a poly-A enrichment, is it necessary to remove DNA, knowing that genomic DNA does not ...
user avatar
2 votes
2 answers
294 views

Which information can be extracted from time course RNA-Seq Data?

So I am very new to the area of biology so I am sorry if this is a stupid question. I have RNA-Seq data carried out over a span of 100 days and I have gene expression data in the following format. ...
user avatar
  • 31
1 vote
0 answers
27 views

RNA extraction from soil

I have been trying to extract RNA from soil without success. I have used commercial kits (The Plant DNeasy kit) because I did not want to buy a complete new kit (Soil) to do 5 extractions. Is there ...
user avatar
  • 111
1 vote
1 answer
81 views

de novo assembly applications

Hey I hope this question supposed to be in this forum. I'm not from the biology community, I'm from the data security community so im not familiar with the words you might use for answers I need to ...
user avatar
1 vote
0 answers
83 views

The advantages of using a strand specific cDNA in RNA-Seq?

May I ask what are the advantages of using a strand specific cDNA library in an RNA-seq experiment? as far as I know it can make us able to read the code region but what about other advantages?
user avatar
  • 11
0 votes
1 answer
60 views

Is my RNA-seq experimental design correct to use it for SNP calling?

I am a newbie here and would highly appreciate your advice about one particular experimental design. We have data from RNAseq experiment which was originally designed to assess differential ...
user avatar
  • 3
7 votes
2 answers
956 views

Biological meaning of read length

I have some FASTQ files in two datasets which are sequences from 16Srna region. The first dataset is amplicons form V4 region and the second is V3-V4 region. However all the reads are 250 nucleotides ...
user avatar
  • 175
2 votes
0 answers
36 views

When to decide that two similar sequences are different genes or not?

Working on RNA-Seq data directed me to ask this question. In RNA-Seq jobs, after de novo assembly we have lots of transcripts with different rates of similarity (0 to almost 100 percent) that we ...
user avatar
  • 2,284
0 votes
1 answer
189 views

16s rRNA Sequencing From Gut Microbiome (stool)

Do I extract RNA or DNA from gut microbiome (stool samples) if want to do 16s rRNA sequencing?
user avatar
  • 1
1 vote
1 answer
370 views

the meaning of "Non-primary hits" and "tags"

Can I ask you to help understand the meaning of "Non-primary hits" and "tags" in the following paragraph related to RSeQC: The result table reports total number of reads (excluding nonprimary hits) ...
user avatar
  • 11
0 votes
1 answer
847 views

What is the meaning of the word 'bin' in the context of RNA-Seq?

I have a question from a book about RNA-Seq. I would like to know the meaning of the word "bin" in the below cited paragraph: RseQC has several nice features not found in the other programs: (a) ...
user avatar
  • 11
1 vote
1 answer
256 views

Which are the best programs to analyze circular RNA?

Hello I'm just started with bioinformatics and I would like to know which programs are best for the task of finding circRNA (circular RNA) in sequences of tissues and different cellular types. I have ...
user avatar
1 vote
0 answers
35 views

Blastx: from gi to description

I have done a blastx and use the outfmt 6 option, because I want to work in the tables format. When I do this I get subject ids of the type sp|Q7XJS0|ASHR1_ARATH, sp|Q39547|CUCM1_CUCME, et cetera....
user avatar
1 vote
1 answer
147 views

How do I read an RNA expression pattern?

When reading about diseases one can find links to proteins and their associated genes, an example of which is here. I'm wondering how to decode/read the following graph as a non-specialist in this ...
user avatar
3 votes
1 answer
135 views

correction of read counts for spikes

I have 4 RNA-seq samples (1st is control and the other 3 are treatments) and 5 spikes. I used different concentrations for 5 spikes but over different samples, I used similar concentration. for ...
user avatar
2 votes
2 answers
214 views

How much tissue is required to do RNA-seq analysis on a single organism?

How much tissue would be required to do RNA-seq analysis on a single organism? More specifically, if a person wanted an RNA-seq analysis of expression for a single organ, how much tissue would they ...
user avatar
  • 121
1 vote
1 answer
321 views

Multiple transcripts matching same gene in de novo assembled RNA-seq data, but FPKM values vary?

I have a data set of de novo assembled RNA-seq datasets across different sample types. When BLASTing, many of the matches of the individual transcripts match to the same gene on the reference genome. ...
user avatar
0 votes
1 answer
82 views

where i can download reference MSU7 rice genome?

I am working with RNA Seq data analysis. I have to download MSU7 rice genome. somehow i downloaded from "http://rice.plantbiology.msu.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/...
user avatar