Questions tagged [rna-sequencing]

Determining the sequence of RNA. This technique is used for discovery and quantification of mRNAs and ncRNAs.

Filter by
Sorted by
Tagged with
-1
votes
0answers
33 views

I am interested in RNA- Sequence data, I have a gene of interest and cancer. I want to download the data from TCGA Data portal

I am interested in RNA-Sequence data, I have a gene of interest and cancer. I want to download the data from The Cancer Genomic Atlas Data portal.
0
votes
1answer
65 views

Can Cas13 be used with multiple crRNAs in the same reaction?

CRISPR-Cas13 equipped with crRNA (complementary to transcripts of interest) can be designed to target ssRNA transcripts in cells. Upon successful crRNA and ssRNA binding, a fluorescent domain on ...
0
votes
1answer
61 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
8
votes
1answer
999 views

RNA seq and using of Poly(A) or non-Poly(A) based amplification of RNA

I'm studying "Deep sequencing the circadian and diurnal transcriptome of Drosophila brain" Hughes et al., 2012. I've got some problems with the materials and methods. Before RNAseq, the ...
0
votes
0answers
10 views

What is the amount of mRNA transported by exosomes?

I would like to better understand, if possible, what kind of RNA molecules exosomes transport in human cells. The experiment behind this general question is our goal to do a combination of mRNA-Seq ...
4
votes
2answers
144 views

Do housekeeping genes vary between tissues

I am working on an RNA-Seq project, and I am aware that some researchers use housekeeping genes as a method of normalization. My project has several different tissues, and I was wondering if ...
1
vote
1answer
119 views

Where is DNA during the process of RNA extraction using Trisure?

Where is DNA during the process of RNA extraction using Trisure described here? Given that DNA is also a nucleic acid, should I expect the isolated RNA to also contain DNA? However, Bioline claims RNA ...
1
vote
0answers
14 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
1
vote
0answers
14 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
0
votes
0answers
13 views

Alzheimer's datasets highlighting role of individual genes

A question to the folks who studies Alzheimer's disease here. My colleagues and I have developed a new program that predicts the master regulators based on transcriptomic changes (yes, another one). ...
0
votes
0answers
18 views

Viral RNA enrichment vs. filtering the reads out

I see a lot of advertisement for viral enrichment kits, e.g. Twist Biosciences hybrid preps, which should allow to "fish" for viral DNA in vitro. Now there is another method exploited by a paper that ...
-1
votes
1answer
25 views

What is multiplet nuclei capture rate?

I met this terminology in a publication.https://core.ac.uk/download/pdf/226940818.pdf. It's in the last sentence of the second paragraph in the text. I tried to search for it but didn't get a ...
3
votes
1answer
111 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
1
vote
1answer
110 views

Confusion about read counts distribution in RNA-seq

While reading old DESeq paper (Anders and Huber 2010) I came across following line. If reads were independently sampled from a population with given, fixed fractions of genes, the read counts ...
-1
votes
1answer
40 views

Where to find a list of genes coding for protein in human

I have raw read counts extracted by htseq from STAR alignment I have both data with both Ensembl IDs and gene symbols, but I need only a latest list of protein coding genes in human; I googled but I ...
2
votes
0answers
32 views

What does the final (Illumina) RNA-seq library contain? ss cdNA or ds cDNA?

I guess the oligos on Illumina's flow cell only hybridize to to single-stranded cDNAs (sscDNA). However, when I read the TruSeq protocol (googled: TruSeq® RNASample Preparation v2 Guide) at the PCR ...
0
votes
1answer
40 views

How to do desalt reaction by passage through a Micro Bio-spin 6 column?

I want to perform the bisulfite sequencing on rRNA to detect the 5-mC. I followed this protocol • DNA-free™ DNA Removal Kit (Invitrogen) • Purified RNA, Treat RNA according to manufacturer's ...
1
vote
0answers
41 views

How to map the N6-dimethyladenosine by primer extension?

I am trying to map N6-dimethyladenosine on rRNA using primer extension (low dNTPs assay) method. But i am not able to detect map my position. I went through some articles they mentioned like they ...
0
votes
0answers
38 views

Why do the RNAseq reads map to only a certain region of a viral genome?

I am looking at RNAseq data and mapping them to 3 RNA segments from Cucumber Mosaic Virus. I trimmed the adapters from the fastq files and converted them to fasta, which I searched against a virus ...
0
votes
2answers
56 views

identification of differentially expressed genes in RNA-seq analysis [closed]

I am using four different packages (viz. EBSeq, DESeq2, edgeR, LPEseq) for identification of differential genes. Now I am confused whose fold change value should I take for further downstream ...
0
votes
1answer
54 views

Is there a data base, tool or method I can use to find out which of my genes code for cytokine receptors?

I have a list of over 600 differentially expressed genes from my single cell RNA seq data analyses. I want to proceed to find out which of my genes code for cytokine receptors so that I can show on a ...
7
votes
2answers
131 views

Sequence of ribosomal RNA

Is it possible to sequence rRNA directly, that is, using the ribosome rather than the DNA from the nucleus? For example, this paper, Complete nucleotide sequence of a 16s rRNA gene from E. coli, ...
8
votes
1answer
156 views

Iron metabolism in the brain

I did an expression profiling from publicly available RNAseq data for mouse tissues. While for liver and testes I am getting expected proteins in the top highly expressed mRNAs, for brain I am getting ...
0
votes
1answer
203 views

What do HG and NA mean in Geuvadis project RNAseq sample labels?

I'm looking at RNASeq Data from Geuvadis website e.g. the file GD660.GeneQuantRPKM.txt.gz. The samples are labeled by e.g. HG00105.1.M_120209_7 or NA20812.2.M_111216_6 What do HG and NA mean? Are ...
4
votes
5answers
914 views

Why analyse transcriptome instead of proteome?

Analysing the transcriptome (RNA-Seq, microarrays, qPCR etc) is probably the most widely used technology to assess gene expression and dynamic cellular processes. The results are then extrapolated (...
2
votes
2answers
287 views

Which information can be extracted from time course RNA-Seq Data?

So I am very new to the area of biology so I am sorry if this is a stupid question. I have RNA-Seq data carried out over a span of 100 days and I have gene expression data in the following format. ...
1
vote
0answers
21 views

How many samples to run an association study on B-Cell receptors

We are trying to find biomarkers on the B-Cell receptor VDJ regions. To do this we plan to run Single cell RNA-Seq (using the solution from 10x genomics https://www.10xgenomics.com/solutions/vdj/) to ...
2
votes
1answer
29 views

Metatranscriptomics Extraction

I am attempting to perform metatranscriptomics analysis of a cleanroom. The DNA input is known to be rather low (<1pg). Despite this, I want to still attempt to try it. I am thinking it might be ...
1
vote
1answer
73 views

If a person is infected with an RNA virus what percentage of the RNA in the blood of the person contains RNA of the virus?

Karius uses DNA sequencing of everything that's contained in a sample to detect all bacteria and DNA-viruses in the sample. Given the way that costs of sequencing are falling this approach seems to be ...
-2
votes
2answers
71 views

Correct structure of RNA [closed]

Of the 2 figures, which is the correct structure of RNA, This is the link : 1: https://i.stack.imgur.com/IYgyv.jpg Sorry, the figure is not to scale. If there's any problem with the question ...
2
votes
0answers
83 views

RNA contains Uracil in place of Thymine [duplicate]

Thymine does not present in RNA but DNA containing thymine why
0
votes
1answer
22 views

dbSNP clarification

I am currently going through this paper - link. In their methods section the authors have described they have used dbSNP for checking biallelic expression of genes. I would like to know if dbSNP ...
1
vote
0answers
58 views

Should I use glycogen in isopropanol to precipitate RNA or does glycogen have harmful consequences on downstream protocols such as RNA seq?

I have heard that one can use glycogen in isopropanol to better visualise the RNA pellet after centrifugation. What are the advantages and disadvantages of adding glycogen in isopropanol for RNA ...
1
vote
1answer
250 views

Should I use RNAseZAP on my bench and pipettes before RNA extraction?

Should I spray RNAseZAP on my bench and pipettes before working with RNA? I am regularly using RNase at my bench and would like to work with RNA as well. Could traces of RNase on my equipment degrade ...
1
vote
0answers
251 views

Is DNase treatment necessary before RNA sequencing?

Is it necessary to treat total RNA with DNase before sequencing it? In particular, if the library prep relies on a poly-A enrichment, is it necessary to remove DNA, knowing that genomic DNA does not ...
0
votes
1answer
75 views

de novo assembly applications

Hey I hope this question supposed to be in this forum. I'm not from the biology community, I'm from the data security community so im not familiar with the words you might use for answers I need to ...
1
vote
1answer
320 views

the meaning of “Non-primary hits” and “tags”

Can I ask you to help understand the meaning of "Non-primary hits" and "tags" in the following paragraph related to RSeQC: The result table reports total number of reads (excluding nonprimary hits) ...
1
vote
0answers
25 views

RNA extraction from soil

I have been trying to extract RNA from soil without success. I have used commercial kits (The Plant DNeasy kit) because I did not want to buy a complete new kit (Soil) to do 5 extractions. Is there ...
1
vote
0answers
81 views

The advantages of using a strand specific cDNA in RNA-Seq?

May I ask what are the advantages of using a strand specific cDNA library in an RNA-seq experiment? as far as I know it can make us able to read the code region but what about other advantages?
0
votes
1answer
60 views

Is my RNA-seq experimental design correct to use it for SNP calling?

I am a newbie here and would highly appreciate your advice about one particular experimental design. We have data from RNAseq experiment which was originally designed to assess differential ...
7
votes
2answers
949 views

Biological meaning of read length

I have some FASTQ files in two datasets which are sequences from 16Srna region. The first dataset is amplicons form V4 region and the second is V3-V4 region. However all the reads are 250 nucleotides ...
0
votes
1answer
169 views

16s rRNA Sequencing From Gut Microbiome (stool)

Do I extract RNA or DNA from gut microbiome (stool samples) if want to do 16s rRNA sequencing?
2
votes
1answer
168 views

Do all microRNA isoforms need to be known and sequenced to obtain microRNA expression?

From what I understand, microRNA are short "hairpin" shaped nc structures. When sequencing and counting miRNA, isoform miRNA are "found" which are subsections of varying length and possibly with some ...
2
votes
0answers
35 views

When to decide that two similar sequences are different genes or not?

Working on RNA-Seq data directed me to ask this question. In RNA-Seq jobs, after de novo assembly we have lots of transcripts with different rates of similarity (0 to almost 100 percent) that we ...
5
votes
2answers
3k views

How were the first primers made?

I keep reading about how primers are useful in pcr -- they allow you to select a specific dna region. Similarly, in NGS or Sanger sequencing they give you a starting point. The primers I see are about ...
1
vote
1answer
254 views

Which are the best programs to analyze circular RNA?

Hello I'm just started with bioinformatics and I would like to know which programs are best for the task of finding circRNA (circular RNA) in sequences of tissues and different cellular types. I have ...
1
vote
1answer
303 views

Multiple transcripts matching same gene in de novo assembled RNA-seq data, but FPKM values vary?

I have a data set of de novo assembled RNA-seq datasets across different sample types. When BLASTing, many of the matches of the individual transcripts match to the same gene on the reference genome. ...
0
votes
1answer
28 views

RNA seq: Should non-infected units be used for RNA-seq?

I am designing a RNA-seq experiment to study transcriptomic profile changes upon parasite exposure. Some papers I read, mostly extract RNA from the entire treatment group (organisms exposed to ...
0
votes
1answer
690 views

What is the meaning of the word 'bin' in the context of RNA-Seq?

I have a question from a book about RNA-Seq. I would like to know the meaning of the word "bin" in the below cited paragraph: RseQC has several nice features not found in the other programs: (a) ...
3
votes
1answer
128 views

correction of read counts for spikes

I have 4 RNA-seq samples (1st is control and the other 3 are treatments) and 5 spikes. I used different concentrations for 5 spikes but over different samples, I used similar concentration. for ...