Questions tagged [rna]

RNA, or ribonucleic acid, is a biological macromolecule made of nucleotides used in cells to convey genetic information to protein. RNA also plays a role in catalyzing certain biological reactions as well as carrying genetic material in some viruses.

Filter by
Sorted by
Tagged with
-2
votes
0answers
36 views

The role of the missing oxygen: is it possible for DNA and (redesigned) RNA to play each other's role? [duplicate]

RNA can form double helix Is there a double helix RNA?, single strand DNA can fold and play functions as good as RNA Can DNA produce ribozyme-like structures?. Is using DNA as inheritance information ...
1
vote
0answers
39 views

How does RNA polymerase II CTD bind to the RNA modification proteins if the tail is flexible?

The tail of RNA polymerase II is flexible, not folded into a fixed structure , but does each repeat have more "rigid" structure (i.e. fold into a structure that has less rotation freedom ...
0
votes
1answer
71 views

Do RNA modification proteins bind to specific repeats on the RNA polymerase II CTD?

The C-terminal domain (CTD) of human RNA polymerase II has 52 repeats of a similar heptapeptide sequence. Will the RNA modification proteins only bind to some repeats at specific locations on this (e....
-2
votes
2answers
51 views

Destroying RNA of viruses using Ribonuclease

I wonder if it is possible to design some Ribonuclease to destroy only specific RNAs (like those of viruses). Then, if virus tries to infect, his RNA will be cut. Or, instead of creating Ribonuclease, ...
0
votes
0answers
30 views

How did Rna replicate according to Rna World Hypothesis?

I was studying Rna World Hypothesis in Khan Academy, and there is a line..... The RNA world hypothesis suggests that life on Earth began with a simple RNA molecule that could copy itself without help ...
1
vote
0answers
47 views

RNA vaccination and Autoimmune Reactions

To my knowledge we do not have any robust experience with RNA vaccination. Most likely this will change in the near future as RNA vaccines against COVID are in the pipeline. The rationale behind this ...
9
votes
2answers
600 views

Does double stranded RNA (dsRNA) exist in eukaryotic cells?

I know it sounds like a stupid question. Obviously, tRNAs and rRNAs, for example, form loops and could therefore be considered as dsRNAs... but are they really considered as such? Are there examples ...
1
vote
0answers
17 views

What prevents the translation of the negative strand of negative-sense viral genomic RNA?

Some RNA viruses contain negative-sense RNA. Then they use this negative-sense RNA to make positive-sense RNA that is then translated into protein. My question is what prevents the translational ...
1
vote
0answers
14 views

How to construct a sgRNA library with multiple samples?

I was wondering if anyone has already experience with constructing sgRNA libraries. We are interested in doing a knock-out experiment (loss-of-function) with 5 different conditions. I have found this ...
1
vote
0answers
13 views

Peak-calling in CLIP: What is the effect of RNA-concentration?

I hope it's ok to repost my question from 8 months ago from StackExchange:Bioinformatics, that is still in beta. https://bioinformatics.stackexchange.com/questions/10730/peak-calling-in-clip-what-is-...
1
vote
1answer
64 views

Do DNA viroids exist?

Viroids are described as short circular ssRNA with no protein coating. Are there any analogous infectious particles that contain DNA instead of RNA? If DNA viroids do not exist, is there an obvious ...
0
votes
1answer
38 views

Why are some parts of an rRNA structure diagram not labelled?

I've been looking at this structure diagram of the 16S rRNA and have been wondering why some parts of the diagrams have labelled base pairs while other parts are just lines and dots. I'm new to this ...
0
votes
1answer
43 views

What is the role of pyrophosphatase in RNA polymerization?

In Molecular Cell Biology (8th edition) there's a fragment in chapter 5.2 that says: The energetics of the polymerization reaction strongly favor the addition of ribonucleotides to the growing RNA ...
0
votes
2answers
78 views

VPg priming of the replication of RNA viruses

I'm doing a presentation on the replication of SARS-CoV-2 for my chemistry class, and I found that to replicate its RNA, the virus uses RNA-dependent RNA polymerase, which is primed by a VPg primer. ...
-1
votes
1answer
72 views

Why does the structure of RNA change? [closed]

RNA only has one strand, but like DNA, is made up of nucleotides. RNA strands are shorter than DNA strands. RNA sometimes forms a secondary double helix structure, but only intermittently. Why does ...
0
votes
0answers
17 views

Construct aptamer library with exact number of members

I am asked to construct an aptamer library of exactly 1024 members, each with a unique V. I have two questions regarding this; firstly, is it wrong to construct an aptamer library using a column with ...
1
vote
0answers
48 views

Why all negative ssRNA viruses have helical capsids?

You can always say it's a coincidence, but is there particular need to have a helical capsid? Do they need their RNA to be more protected than +ssRNA? Is it better for RdRp attachment? This paper ...
1
vote
1answer
52 views

Why is an intron (or exon) still called intron (exon) if retained in (excluded from) mRNA?

In most explanations, the sections of RNA removed during splicing are called introns, and the remaining segments that are stitched together are called exons. That is, introns and exons are defined in ...
4
votes
0answers
29 views

Why can oligo-U not be used to isolate mRNAs, instead of oligo dT?

dTTP oligonucleotides are used to isolate mRNAs because mRNAs (in eukaryotes) have a poly A tail which binds to the complementary oligo-dT. However, why can we not use oligo-U instead (uracil)? I ...
-1
votes
2answers
59 views

How can I classify the 3 clades(S, G, V) of the coronavirus that are found on GISAID?

On GISAID they classified the corona using 4 clades(S, G, V, Other). I would like to know exactly how these genomes were classified for my research. So how do you classify a coronavirus genome as ...
3
votes
1answer
104 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
0
votes
1answer
40 views

Does the Abbott ID NOW coronavirus test return a positive result if you take it while you're still in the incubation period? [closed]

It seems like Abbott's ID Now test works by detecting the virus directly as opposed to checking for antibodies? If the test result is negative does that mean you don't have the virus? Or does that not ...
2
votes
1answer
45 views

Roughly speaking how stable are short sections of single-stranded RNA in exposed environments compared to double-stranded DNA?

A search following a recent news item led me to a CDC Morbidity and Mortality Weekly Report for 23 March 2020 which says in part: SARS-CoV-2 RNA was identified on a variety of surfaces in cabins ...
15
votes
1answer
8k views

How many times has SARS-CoV-2 mutated?

According to Coronavirus has mutated at least once The novel coronavirus that has infected thousands of people across the world may have mutated at least once — meaning there may be two ...
1
vote
1answer
95 views

Expression of eukaryotic ribosomal DNA

The Wikipedia page for rDNA says "Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA" Also, the figure next to it says "The gene segment of eukaryotic rDNA contains 18S, 5.8S, and 28S ...
0
votes
1answer
65 views

A question about dna triplex

Short DNA triplex strands have been identified in various organsims. But, would injecting a single strand of DNA or RNA (with its bases complementary to the bases of DNA found in the major groove of a ...
1
vote
1answer
22 views

what happens to rna length if we have a termination site in additional to the original one [closed]

if we have an RNA transcription and we add an additonal temination site in the middle , will i have two RNA molecules or just a short one ?
0
votes
1answer
83 views

How to design the primer when you don't have GC?

I have treated my RNA with sodium bisulfite so all my cytosine is converted into thymine. Then I used that RNA for my RT reaction. I have a cDNA template without Cs. Now I am trying to amplify that ...
2
votes
1answer
29 views

I added ethanol to my TRizol RNA extraction

I added ethanol instead of chloroform to the cell suspension in Trizol. Can I still obtain my aqueous phase?
2
votes
0answers
59 views

Detect differentially expressing cells

I have data (RNA expression values, obtained with in situ hybridization) collected from 1mio human cells. For each cell, I have the expression value of a negative control (non-human RNA) and single-...
1
vote
1answer
29 views

What percentage of RNA splicing happens during transcription?

Splicing can happen either during transcription, or directly afterwards. I am reading about single-cell RNA seq, and according to this paper, they observed that 15–25% of reads contained unspliced ...
3
votes
1answer
81 views

The shape of mRNA

I was wondering about the shapes assumed by mRNA. I have read some sources quoting that it is linear (quora, so not very reliable) and also a source that says a hairpin shape is common (nature, so I ...
0
votes
4answers
119 views

Why do mutations not take place in mRNA of higher eukaryotes?

Is it because it is too short-lived to be mutated? Both DNA and RNA are nucleic acids so how is mRNA protected? RNA viruses undergo mutations to evolve so I guess it is not immune to mutations
0
votes
1answer
56 views

Where can I obtain the sequence of the E. coli ribosomal RNA precursor?

I have found separate sequences for 16S rRNA (from the small subunit) and 23S rRNA and 5S rRNA (from the large subunit). I need the full precursor rRNA sequence, which I cannot find. However the ...
0
votes
1answer
52 views

How to reduce the number of sequences in a Multiple Sequence Alignment?

I have a Multiple Sequence Alignment, where there are around 5000 sequences. There also exists many sequences where, there are so much of non-sequenced regions (for instance, AU----CGGGCA--NNNNNNNNNN)....
2
votes
1answer
57 views

Non-nucleated cell-like population with RNA

We're working on invertebrate hemolymph (blood) and we have found with flow cytometry (staining with DRAQ5) a cell-like population without nucleus but it has RNA production. Does anyone any ...
2
votes
1answer
77 views

What is the difference between DNA vs RNA Editing in the context of gene therapy?

As a someone with beginner knowledge on biology, I have come across the terms "RNA editing". Take this paper for example : RNA Editing with CRISPR-Cas13 From my understanding, DNA -> RNA -> Proteins ...
0
votes
0answers
42 views

Which database has the ready made 16S rRNA Multiple Sequence Alignment File that I can download directly from?

In my case, I need the ready made 16S rRNA Multiple Sequence Alignment File for E.coli and use it to generate the phylogenetic tree file in Newick format. I've tried using the one from utexas website, ...
1
vote
0answers
38 views

How to map the N6-dimethyladenosine by primer extension?

I am trying to map N6-dimethyladenosine on rRNA using primer extension (low dNTPs assay) method. But i am not able to detect map my position. I went through some articles they mentioned like they ...
0
votes
0answers
45 views

How to detect specific mRNA dsRNA by Northern analysis?

I silenced a gene by RNAi method, for that i chose the gene and the size of the gene is 1.5kb and my insert size is 500nts. i did the transfection and i want to confirm the silencing by northern ...
2
votes
1answer
151 views

Why does 4-thiouracil labelling to map RNA-binding proteins cause a T-C change?

I am now reading a paper about the purification and identification of mRNAs and its RNA binding proteins by using UV crosslinking and immunoprecipitation. I came upon this sentence which puzzled me ...
1
vote
1answer
187 views

Why does a cell need siRNA?

My question is about small non-coding RNAs. miRNA and siRNA are both known for mRNA regulation. miRNA can both transcriptionally inhibit and degrade mRNA by cutting it. For inhibition just a small ...
1
vote
2answers
283 views

Why do we use cRNA instead of initial extracted RNA in the microarray technique?

I am recapping for the exam in transcriptomics and stumbled into a question about microarray. So, our regular workflow is to extract RNA from cells generate cDNA from the initial RNA using reverse ...
4
votes
1answer
3k views

Who created the codon wheel chart (not as a table)

I'm trying to find out who created or first used the codon wheel chart as far as we can know? (I don't mean the tabular format)
0
votes
1answer
21 views

Can I ask tip for tissue measuring(especially for RNA preparation)?

I extracted RNA at mouse liver and human blood, but degradation occurs. I think, at mouse liver, too hard to measuring 50mg liver(I am newbie for animal tissue preparation) so spend several minutes. ...
0
votes
3answers
627 views

Double stranded RNA Single stranded DNA

I have seen in textbooks referring to ds RNA and ssDNA. How a RNA can be double stranded and likewise how a DNA can single stranded and if they do exist why are there names not interchanged?
1
vote
0answers
50 views

Exporting RNA in extracellular vesicles (exosomes)?

I'm interested in how much is know about the process by which RNA is secreted from cells into extracellular vesicles. Where is a good place to start reading about this? How much is known about this ...
1
vote
1answer
500 views

Do ribosomes read mRNA?

So I understand that tRNA bonds to a codon (with an anticodon) in the translation process. I read in my biology textbook that the ribosomes "read" the mRNA strand. Why do the ribosomes need to read ...
1
vote
2answers
69 views

Name of dsRNA (or dsDNA) where all strands are identical

What is the name of dsRNA (or DNA) where all component strands are identical (i.e. where the complex consists of multiple copies of the same ssRNA)? Example: 2 identical ssRNAs forming a dsRNA ...
2
votes
2answers
1k views

What makes/breaks the hydrogen bonds between DNA and RNA during transcription?

So I know that RNA polymerase catalyzes the phosphodiester bonds that hold the sugar backbones of a growing mRNA molecule together during transcription. However, I'm less sure about the hydrogen bonds ...

1
2 3 4 5
7