Questions tagged [virology]

Virology deals with the study of viruses, infectious entities that require the machinery of a host cell to replicate.

Filter by
Sorted by
Tagged with
0
votes
1answer
34 views

What are the short/long term effects of chloroquine on fundamental cell processes?

Does chloroquine, which affects the endosomal membrane traffic pathway (by affecting the acid environment used for fundamental endosomal reactions), have short/long-term effects on cell growth/...
12
votes
1answer
2k views

Coronavirus capsid missing?

According to several sources, Coronavirus is a helical virus, i.e. it should have a helical capsid. Although most sources did not labelled or pointed any kind of capsid. It was mysterious to watch ...
0
votes
0answers
45 views

Does a longer exposure to covid-19 mean a higher viral load AND a worse infection?

I'm interested in knowing whether it's worse for someone to be exposed during a longer time to someone with covid-19 (coronavirus). Does it work that way? 1) Does that mean that I would get a higher ...
0
votes
2answers
33 views

How verified experimentally is the Marginal Value Theorem for viruses?

Reading some Stanford notes on R0, they get to MVT and optimal virulence: Consider a directly-transmitted infection from which there is no recovery (e.g., Herpes Simplex). The population ...
36
votes
4answers
5k views

Why do some viruses cease being a problem even though no vaccine or cure is found?

No vaccine or cure has been found for SARS-CoV or MERS-CoV yet the world is not too concerned about them. How can it be? Did all people who had those viruses die or do viruses just randomly decide to ...
1
vote
1answer
172 views

Using decoy proteins to treat viral illness

As a non-biologist, my understanding is SARS-CoV-2 uses it spike protein to latch on to the ACE2 receptor on cells in order to inject its genetic material into the cell. Questions: What would happen ...
3
votes
2answers
68 views

Can a bacterium express a virulence gene and not produce toxins and what may be the cause of this?

I am preparing a seminar on viable but non-culturable (VBNC) state in bacteria, mainly foodborne pathogens and I just saw this line in a journal article by Lothigius et al that "the expression of the ...
5
votes
1answer
184 views

What are the secondary structure requirements for cell-penetrating peptides AKA protein transduction domains

Cell penetrating peptides. Cell penetrating peptides (CPPs) are a class of short amino acid sequences which are sufficient for crossing cell membranes and delivering themselves along with any ...
2
votes
1answer
93 views

Why is the GenBank entry for the genomes of RNA viruses like coronavirus written as DNA?

The reference genome in GenBank of the sars coronavirus from Wuhan is written in the following format: attaaaggtttataccttcc (The first 20 nucleotides) ...
21
votes
2answers
5k views

Why don't we have vaccination against all diseases caused by microbes?

People can be vaccinated against certain diseases. Principle of vaccination is to use live attenuated load or inactivated. My question is - why we dont have vaccination against all diseases which are ...
0
votes
2answers
35 views

Is it possible for virus infected cells to continue to present a self-antigen on the MHC1?

Forgive my ignorance, as I'm new to immunology, however it seems like there would be some amount of positive selective pressure for viruses to develop the ability to continue to present the host's ...
4
votes
1answer
41 views

Has there ever been a published experiment to take a viral “census” of a human subject's blood?

Has there ever been a published experiment to take a viral "census" of a human subject's blood? By a "census", I mean to identify every active virus in the subject's blood with some probability. So,...
3
votes
3answers
244 views

How are viruses isolated?

I read several different articles about virology, including the Wikipedia article on viruses and none of them explain how a virus is isolated. Some talk of injecting a virus into a chicken egg, but ...
-1
votes
1answer
57 views

Why are bats so resistant to getting disease from viruses? [duplicate]

I saw in the YouTube video COVID-19 that bats carry so many viruses, yet never or almost never get a disease by any of them. I'm looking for an evolutionary reason as well as a reason based on how ...
-1
votes
1answer
42 views

Poor Hygiene vs. Cross-species transmission?

Did a poor hygiene at wet Chinese markets add anything to equation to trigger critical mutation of COVID-19 helping it to transmit the virus from bats/pangolins to humans? If not, would it spread to ...
2
votes
1answer
57 views

How can viruses have an incubation period of only 3 days?

Cold viruses seem to typically have incubation periods of 3 days, but from a mechanical point of view, I wonder how this is possible? For example, if we read this viral assay protocol document: https:...
0
votes
1answer
49 views

Could an exposure to a small amount of viruses result in an easier course of the disease?

According to Gunther Hartmann (Professor of Clinical Chemistry and Pharmacology at the University of Bonn) cited in this article (Süddeutsche Zeitung, in German) Die Zahl der Erreger hat bei ...
1
vote
0answers
20 views

Difference between infectivity and cell fusion abillity of Virus. (COVID 19)

I'm a computational chemist who have interest in COVID-19. As a physical chemist, I'm lack of basic knowledge for biology. What is the difference between 'infectivity' and 'membrane fusion activity'?...
38
votes
5answers
8k views

Virus cannot survive on surface after certain time period, but why and how?

I'm not a biology student at all, but I'm trying to get a clearer picture on what is meant by "virus cannot survive after a certain period". To my understanding, a virus cannot be killed it can only ...
0
votes
0answers
42 views

What keeps a virus from spreading from one species to the other, when it can infect both?

I have read that there have been cases where animals (some tigers, also a dog) have been infected by Covid-19 through a human host. At the same time, I read that currently it is deemed unlikely that ...
1
vote
1answer
46 views

Making new antibodies

Is there a model of how the B-cell-antibody pool in the lymphoid organ evolves during the first two weeks of infection by a new virus ? With a model I mean something like this At first we have $10^...
1
vote
1answer
57 views

How likely is to develop an infection from a single virion entering a single cell? [closed]

Is there any research (including mathematical or computational modelling) regarding how likely it is to infect an organism starting from a single virion entering a single cell? I am interested in any ...
1
vote
1answer
66 views

What current evidence supports the use of hydroxycloroquine used as a prophylactic for (corona)-viral infections?

I've also read comments from doctors suggesting that hydroxychloroquine has been studied in the past as a potential prophylactic for viral infections. A search through US clinical trials yields many ...
-1
votes
2answers
135 views

How do viral vaccines work?

I have read that a vaccine against a pathogen typically works by using a dead or weakened version of that pathogen and then inciting an immune response against the pathogen so that the immune system ...
0
votes
1answer
43 views

what are the factors that can be used to compute the probability of getting the coronavirus?

Our team and I work on a project for the Lauzhack 2020 and to achieve this work, we need to determine some factors that can tell us what is the probability of contracting the coronavirus. Is there ...
2
votes
2answers
34 views

How did plaques form in Salvador Luria's Bacteriophage experiment (discovery of restriction enzymes)?

I was watching Eric Lander's lecture online describing Luria's experiment (see below for link), and I couldn't understand how plaques form. From my understanding, Bacteriophage infect strain B Viral ...
0
votes
1answer
49 views

SARS-CoV-2 proteome: is the SPIKE protein not an issue for a hospitalized patient?

I am performing molecular docking of ligands using the modeled proteome of SARS-Cov-2. My question is, after a patient is hospitalized, is the SPIKE protein not really an issue anymore, since its role ...
0
votes
1answer
35 views

How much of the genotype-phenotype map do we understand in HIV?

From what I understand, viruses have very small genomes relative to those of standard model organisms used in biological research. For example, according to Wikipedia, "the HIV genome contains nine ...
4
votes
3answers
14k views

Ratio of bleach to water required to disinfect COVID-19?

I am confused about the needed ratio of bleach to water required to disinfect COVID-19 from surfaces. The guide on CDC states that: https://www.cdc.gov/coronavirus/2019-ncov/community/home/cleaning-...
1
vote
1answer
314 views

Why don't anti-viral drugs like “Acyclovir” work against coronaviruses?

I've always used Acyclovir to treat cold sores, why doesn't it work on other viruses? How do coronaviruses differ from herpesviruses?
32
votes
3answers
6k views

Can you be immune to a coronavirus?

Can one be immune to the new coronavirus? Another question is what is the exact definition of "being immune". Does it mean that even when the virus enters my system, it cannot multiply?
45
votes
2answers
6k views

Are all emerging viral diseases of the past 100 years zoonoses?

From my basic understanding: The viruses causing Ebola, Sars and Covid-19 are all the result of a zoonosis, meanings that the viruses have passed from animals to humans. So my question is: Are all ...
-1
votes
1answer
60 views

Zinc, zinc ionophores and viruses

I see that scientist are sometimes trying to use so called "zinc ionophores" to get human cells to take up more zinc. Zinc is believed to sometimes reduce the ability of viruses to replicate, maybe ...
-1
votes
1answer
33 views

Calculating approximate dose of UVs received by a virus

I am making a very approximate calculation to determine the dose of UVs received by a virus standing at 1.5 cm from a UV source during a certain amount of time. Please let me know if my train of ...
13
votes
2answers
635 views

Why are bats the source of dangerous coronavirus pandemics?

Why do coronaviruses come from bats? I mean, why precisely coronaviruses and not (for instance) herpesviruses? It looks like bats host more zoonotic viruses (per species) than rodents, although they ...
10
votes
1answer
3k views

Can viruses survive Super saturated salt solution?

As we know there is less evidence of biological activity in Dead Sea ( Lake full of salt water). Also, our blood cells do not survive in too much salt water as they shrink and die. So I was thinking ...
4
votes
0answers
64 views

Why there is no ELISA for SARS-CoV-2?

As far as I know, SARS-CoV-2 tests currently used worldwide are real-time RT-PCR. Why there is no ELISA for SARS-CoV-2? Compared to PCRs, ELISA is: Way cheaper; Way faster; Does not require trained ...
2
votes
1answer
274 views

Is Covid-19 likely to mutate into a deadlier form?

When the Spanish influenza hit in 1918, it struck in two waves. The first wave was typical for a flu virus, targetting mainly elderly people, but the second wave was far deadlier and killed far more ...
6
votes
1answer
117 views

If rabies always kills its hosts, must there be some animal that is an asymptomatic carrier?

I searched a lot on the Internet, but I am not clear about the spread of the rabies virus. As I understand, rabies kills any animal it infects—cats, dogs, foxes, bats, humans. If it kills all of its ...
7
votes
2answers
3k views

How exactly does alcohol solution kill or neutralize viruses?

To reduce the risk of infection by viruses (including 2019-nCoV) the CDC suggests: Wash your hands often with soap and water for at least 20 seconds. Use an alcohol-based hand sanitizer that contains ...
9
votes
1answer
550 views

Is COVID-19 claimed to get less deadly over time? If so, why?

From a TV news report of a press conference from (I think) the German Robert Koch Institute, I remember hearing an expert declare that he was expecting COVID-19 to get less deadly over time. ...
4
votes
0answers
137 views

How was 2019-nCoV (Wuhan coronavirus) identified so quickly?

It seems that from the first few cases to identifying 2019-nCoV as a new disease happened very quickly. How were they able to identify this as a new disease and not an outbreak of a previously known ...
1
vote
0answers
36 views

What are the exact characteristics for something to be considered a novel virus? [closed]

I've heard viruses being referred to as "novel" - is there an exact definition for what this means?
-1
votes
1answer
158 views

Do microorganisms contain water?

This may sound a bit strange question, but I am very new to biology. I would like to ask that do microorganisms like viruses, bacteria, amoebas, etc also contain water, as every living thing contains ...
3
votes
1answer
210 views

What percentage of individuals infected with COVID-19 don't have symptoms?

There are various statistics estimating mortality of COVID-19 infections, based on how many diagnosed people have died. These numbers are used by various media to extrapolate how many people will die ...
0
votes
0answers
57 views

How does increased relative humidity change the airborne survival rate of coronavirus COVID-19?

I would like to make some HVAC recommendations in my community to assist in slowing the eventual spread of coronavirus COVID-19. Some recommendations are obvious like properly maintained HEPA ...
96
votes
2answers
15k views

What's the evidence against SARS-CoV-2 being engineered by humans?

A couple of colleagues suggested in a discussion that the virus that causes COVID-19 appears to be made by humans, since nature could not have produced such an efficient virus — that spreads so fast ...
0
votes
0answers
14 views

How many antibodies exist in the blood stream while the human body is fighting a virus?

Let a be an antibody of a specific virus v produced by the human body when infected. Call ...
29
votes
1answer
7k views

Does the genetic sequence of SARS-CoV-2 end with 33 A's?

Looking at the DNA (or RNA?) sequence of the Covid-19 virus here: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 I notice it ends in 33 a's. Does the virus really look like that, or is it some ...

1
2
3 4 5
11