8

So there are a couple of things to bear in mind. pluripotent does not mean that all genes are active. It means that the stem cells have the ability to form different cell types. However, it still needs to keep the cellular programme of a neuron for example silent. So the epigenome is still present to keep other cell type programmes silent until there is a ...


7

The genome is the complete set of DNA in an organism, including genes and non-gene sequences of base pairs (bp).1 Each codon of three base pairs in a DNA sequence specifies one of twenty different amino acids. There are four available bases in DNA; Adenine (A), Thymine (T), Guanine (G), and Cytosine (C). Four letters taken three at a time (where order ...


4

There are definitely genomic DNA sequences that nucleosomes preferentially package in vitro. They are A/T rich and have a periodic structure that facilitates bending. However such sequences would typically not be found on exons in vivo (because their protein-coding potential is reduced). Based on the accumulating literature, active promoters (and regions ...


4

Dyad is the centre of the DNA that is wrapped around the nucleosome core (It basically is the centre of symmetry of the nucleosome). It is a common practice to set it at 0 thereby making incoming DNA half, negative and outgoing DNA half, positive. By oscillations the authors mean that there is a periodic repeat of A/T dinucleotide. IMO it is actually not ...


4

Vision deteriorates for both reasons, but I'm not quite sure how to separate the effects of aging from wear and tear. Cataracts are the leading cause of blindness in the world. Ways in which environment (which falls under the category of wear and tear in my book) affects cataract formation: UV light: people living at high altitudes (e.g. Tibet) have more ...


4

In most tissues, close to 100% of DNA methylation occurs at CpG sites. This provides a straightforward mechanism for epigenetic inheritance. Since C and G are complementary, both strands have the CpG site at the same locus and methylation is either present on both strands or on neither. During replication, each daughter DNA molecule inherits a parent strand ...


4

Within that region, there are multiple genes. Although the same gene may control imprinting for both disorders, the gene(s) causing their phenotypes differ. AS results from underexpression of a single gene, UBE3A, which codes for E6-AP, a protein that functions to transfer small ubiquitin molecules to certain target proteins, to enable their ...


4

Geography does not typically affect the morphology of the human body. In certain special cases, there are physiological adaptations, the most obvious being tanning and acclimatization to high altitude, but these aren't changes in body morphology. So why the difference in children of immigrants? This is because diet, nutrition, and disease have quite strong ...


4

Spermatogenesis (Beginning to end): 64 +- 8 days (range 42 to 76) There is considerable individual variation. This includes time in epididymis. Amann 2008 argue for 74 days based on early study by Clermont 1972. Also argue that biopsies are still needed on top of radiolabelling. Substages: Calculated from Amann 2008, Figure 1 using percent time in 16 ...


4

Epigenetic marks are reversible (you might be aware of induced pluripotent cells). Many animals can regenerate organs with high tissue complexity (such as a limb) and this involves de-differentiation in some species (Sandoval-Guzman et al., 2014). Even otherwise, cells can respond to extracellular/environmental cues to modify their epigenetic state (for e.g. ...


4

First, let me qualify the idea of "problematic" epigenetic modifications by saying that the impact of a modification on an organism is often dependent on the environment. That is to say that outcome is dependent on the interaction of genetics (or epigenetics) and the environment in which the associated genes are expressed; e.g. a mutation or modification ...


4

A methylated nucleotide is the same nucleotide, for the purposes of base-pairing events. The methylated base will be paired with its Watson-Crick opposite after replication, for instance (and methylation will even persist after replication).


3

In tree growth there is principle called The axiom of universal stress whereby the growth is in such a way as to equalise the stress across the whole of its structure. The roots, the stem and the branches are one continuous system and can not be thought of as separate. On a simplistic level for a branch to grow, there must be a corresponding equal and ...


3

Depending on the exact goal of the experiment, the researchers may back-cross both to smooth out genetic variation between individuals and to potentially normalize expression of a transgene, although once you get past the chimeric stage gene expression should be fairly stable. In my experience, back-crossing allows you to generate a genetically-altered mouse ...


3

The hairs you mention are also called "androgenic hairs", meaning their growth and pigmentation is influenced by androgens. These include pubic hair, the hairs on the breast and shoulders (almost exclusively for men) and the beard. It seems, that these hair bulbs have different sensibilities (number and expression of androgen receptors) so they react ...


3

No. Epigenetic information is (by definition) NOT included in the nucleotide sequence, but affects genetic expression. Enhancers/silencers are themselves nucleotide sequences, and therefore not epigenetic information. Methylation is an example of epigenetic information, but a DNA sequence itself is genetic information, even if it affects a gene. ...


3

CG methylation has long been associated with gene silencing due to the generally negative correlation between gene promoter methylation and transcription levels. When CG methylation occurs in the promoter or enhancer region of animals (where these 'CpG islands' tend to be), methylation seems to impede (to some extent) transcription factor (TF) binding. ...


3

There are lots of cases reported now that suggest that overall the firstborn child is usually more intelligent. The articles supporting this are based on behavioural and economic study though, so the biological basis is a little lacking. It's also not clear if this is nature or nurture. The firstborn may benefit from their parents undivided attention ...


3

Dominance is defined based on the phenotype Dominance is defined based on a phenotype of interest. Pick a phenotype, say coat color for example. If genotypes AA and Aa have the same coat color while aa has another coat color, then A is domiant over a. The concept hold even for sequence that do not produce proteins The concept of dominance can be applied ...


3

What the DNAfit test does is analyse some of your genes for common variants (called SNPs - single nucleotide polymorphisms). These are hard-written in your genetic code, they won't ever change (you could in theory have mutations in some individual cells, but we can ignore that). Taking supplements or any other environmental influences will therefore not ...


3

Starting from what appears to be your main question: Can I use SNPs associated with a gene's higher expression to compute the likelihood of that gene being expressed in the brain region? I would strongly advise against using SNPs determine if genes are expressed (at all) in a given tissue.For one thing SNPs that affect expression (then often called eQTLs)...


3

Generally speaking, epigenetic modifications are not inherited as they are reset during embryogenesis. However, subsequent epigenetic modifications can be acquired during the period of pregnancy, which as a mechanism depends on the epigenetic state before the reset and on the physiological conditions of the mother including nutrition, health, stress, etc.. ...


3

I quickly aligned your sequences, and as far as I can tell, the answer is that your "consensus" sequence is a poor match for the 3 other sequences: CLUSTAL format alignment by MAFFT L-INS-i (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-...


2

Should I use genomics or/and exomics or/and epigenomics? Depends on what you want to look at. Whole genome sequencing will give you all the mutations. If you are interested only in the coding part of the genome then you can go for exome sequencing. Though, exome sequencing will save your time and resources considerably, you may lose out a lot of relevant ...


2

According to the key given, the one shaded black on the right is autosomal and one on the left is sex linked. Yes, the answer to b is half because Maria is XhX ans Peter is XY and so the probability of the child having this disease is 1/2.


2

In a wild-type human, you will inherit one paternal chromosome and one maternal chromosome, in this case, chromosome 15. The paternal chromosome which is packaged into the sperm will be methylated in such a way that the Ubiqitin-Protein Ligase E3A (UBE3A) gene is silenced. The maternal chromosome which is packaged into the oocyte will be methylated in such ...


2

Just to fully document the IUPAC advice on this, here is the relevant section from the Nomenclature for Incompletely Specified Bases in Nucleic Acid Sequences as reproduced here in the link provided by @Hamish McWilliam. 5.2. Modified nucleotides In a number of organisms DNA and RNA are modified at certain positions. For instance, the DNA of Escherichia ...


2

The CRISPR Cas 9 system is used to introduce insertion or deletion in a genomic sequence not mRNA. https://www.addgene.org/CRISPR/guide/


2

I don't think there is an obvious contradiction here. (1) Mapping neuronal function to the perception of threat (or emotions in general) is often advertised as well-understood, but in fact it is not. Serotonin-concentration-based models (such as the monoaminergic theory of depression) are unavoidably imprecise because ”the brain is not soup”. Additionally, ...


2

To start I will repost some of an answer I have previously posted, which will explain what evolution is: Evolution is simply a process of change. It is a change in trait values of populations over time. It results from four mechanisms: mutation, migration, drift, and selection. "Evolution means change, change in the form and behaviour of organisms ...


Only top voted, non community-wiki answers of a minimum length are eligible