11

Well, don't use M or B, those are already taken (C or A, and not A, respectively). You can see the full list here: http://www.dna.affrc.go.jp/misc/MPsrch/InfoIUPAC.html (The enWiki article on Nucleobases lists a few others but I would ignore those as 1. D is present in both and 2. they are rare and inapplicable) 5-methylcytosine isn't on there. If you ...


7

The genome is the complete set of DNA in an organism, including genes and non-gene sequences of base pairs (bp).1 Each codon of three base pairs in a DNA sequence specifies one of twenty different amino acids. There are four available bases in DNA; Adenine (A), Thymine (T), Guanine (G), and Cytosine (C). Four letters taken three at a time (where order ...


5

Absolutely. It's a pretty cool process, actually. Most (well...) DNA methylation occurs in the context of what are called CpG; that is, a C (Cytosine) followed by a G (Guanine). Because C and G are the Watson-Crick pair for each other, the sequence on the opposite strand will also be CG. Usually, both Cs are methylated, which turns out to be rather ...


4

There are definitely genomic DNA sequences that nucleosomes preferentially package in vitro. They are A/T rich and have a periodic structure that facilitates bending. However such sequences would typically not be found on exons in vivo (because their protein-coding potential is reduced). Based on the accumulating literature, active promoters (and regions ...


4

Dyad is the centre of the DNA that is wrapped around the nucleosome core (It basically is the centre of symmetry of the nucleosome). It is a common practice to set it at 0 thereby making incoming DNA half, negative and outgoing DNA half, positive. By oscillations the authors mean that there is a periodic repeat of A/T dinucleotide. IMO it is actually not ...


4

Vision deteriorates for both reasons, but I'm not quite sure how to separate the effects of aging from wear and tear. Cataracts are the leading cause of blindness in the world. Ways in which environment (which falls under the category of wear and tear in my book) affects cataract formation: UV light: people living at high altitudes (e.g. Tibet) have more ...


4

In most tissues, close to 100% of DNA methylation occurs at CpG sites. This provides a straightforward mechanism for epigenetic inheritance. Since C and G are complementary, both strands have the CpG site at the same locus and methylation is either present on both strands or on neither. During replication, each daughter DNA molecule inherits a parent strand ...


4

Spermatogenesis (Beginning to end): 64 +- 8 days (range 42 to 76) There is considerable individual variation. This includes time in epididymis. Amann 2008 argue for 74 days based on early study by Clermont 1972. Also argue that biopsies are still needed on top of radiolabelling. Substages: Calculated from Amann 2008, Figure 1 using percent time in 16 ...


4

Epigenetic marks are reversible (you might be aware of induced pluripotent cells). Many animals can regenerate organs with high tissue complexity (such as a limb) and this involves de-differentiation in some species (Sandoval-Guzman et al., 2014). Even otherwise, cells can respond to extracellular/environmental cues to modify their epigenetic state (for e.g. ...


4

First, let me qualify the idea of "problematic" epigenetic modifications by saying that the impact of a modification on an organism is often dependent on the environment. That is to say that outcome is dependent on the interaction of genetics (or epigenetics) and the environment in which the associated genes are expressed; e.g. a mutation or modification ...


4

A methylated nucleotide is the same nucleotide, for the purposes of base-pairing events. The methylated base will be paired with its Watson-Crick opposite after replication, for instance (and methylation will even persist after replication).


3

Depending on the exact goal of the experiment, the researchers may back-cross both to smooth out genetic variation between individuals and to potentially normalize expression of a transgene, although once you get past the chimeric stage gene expression should be fairly stable. In my experience, back-crossing allows you to generate a genetically-altered mouse ...


3

Within that region, there are multiple genes. Although the same gene may control imprinting for both disorders, the gene(s) causing their phenotypes differ. AS results from underexpression of a single gene, UBE3A, which codes for E6-AP, a protein that functions to transfer small ubiquitin molecules to certain target proteins, to enable their ...


3

The hairs you mention are also called "androgenic hairs", meaning their growth and pigmentation is influenced by androgens. These include pubic hair, the hairs on the breast and shoulders (almost exclusively for men) and the beard. It seems, that these hair bulbs have different sensibilities (number and expression of androgen receptors) so they react ...


3

I would think there have to be, though do you mean collecting samples on a regular basis and plotting out the difference at each point? Or do you simply mean the total accumulated change. If it is the latter, the answer is certainly "yes". You have probably seen the Nova documentary "Ghost in Your Genes" (The US, not BBC one). In it they show comparison of ...


3

I can get the ball rolling.. Found a nice paper which looks at this phenomenon in yeast. So as a primer, 8 histone proteins come together to make a spool of sorts which DNA wraps around: Histone proteins have many sequence variants, and each one of them can be covalently modified with methyl, acyl, phospho, SUMO, adp and many other sorts of chemical groups ...


3

In tree growth there is principle called The axiom of universal stress whereby the growth is in such a way as to equalise the stress across the whole of its structure. The roots, the stem and the branches are one continuous system and can not be thought of as separate. On a simplistic level for a branch to grow, there must be a corresponding equal and ...


3

No. Epigenetic information is (by definition) NOT included in the nucleotide sequence, but affects genetic expression. Enhancers/silencers are themselves nucleotide sequences, and therefore not epigenetic information. Methylation is an example of epigenetic information, but a DNA sequence itself is genetic information, even if it affects a gene. ...


3

CG methylation has long been associated with gene silencing due to the generally negative correlation between gene promoter methylation and transcription levels. When CG methylation occurs in the promoter or enhancer region of animals (where these 'CpG islands' tend to be), methylation seems to impede (to some extent) transcription factor (TF) binding. ...


3

Dominance is defined based on the phenotype Dominance is defined based on a phenotype of interest. Pick a phenotype, say coat color for example. If genotypes AA and Aa have the same coat color while aa has another coat color, then A is domiant over a. The concept hold even for sequence that do not produce proteins The concept of dominance can be applied ...


3

What the DNAfit test does is analyse some of your genes for common variants (called SNPs - single nucleotide polymorphisms). These are hard-written in your genetic code, they won't ever change (you could in theory have mutations in some individual cells, but we can ignore that). Taking supplements or any other environmental influences will therefore not ...


3

Starting from what appears to be your main question: Can I use SNPs associated with a gene's higher expression to compute the likelihood of that gene being expressed in the brain region? I would strongly advise against using SNPs determine if genes are expressed (at all) in a given tissue.For one thing SNPs that affect expression (then often called eQTLs)...


3

Generally speaking, epigenetic modifications are not inherited as they are reset during embryogenesis. However, subsequent epigenetic modifications can be acquired during the period of pregnancy, which as a mechanism depends on the epigenetic state before the reset and on the physiological conditions of the mother including nutrition, health, stress, etc.. ...


3

I quickly aligned your sequences, and as far as I can tell, the answer is that your "consensus" sequence is a poor match for the 3 other sequences: CLUSTAL format alignment by MAFFT L-INS-i (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-...


2

This article deals with the effect of phenotypic variation brought on by epigenetic patterns, and how these are inherited to the next generation. Their conclusions? Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by ...


2

Starting out with RNA data is great, since you already have fully spliced entities, despite being in a different dynamic regime. As the chromatin landscape itself is dynamic and High throughput data exploration has only begun in the last decade, consider the following tools and results with care... You may find the following tools helpful: Archalign , ...


2

**** "What is a genomic imprint? How does genomic imprinting take place?"** Genomic imprinting is an epigenetic mechanism of inheritance which allows genes to be expressed differently depending on which parent they come from. This means it is modification of the genome, or changes what the genome produces, without changing the nucleotide (DNA) sequence. ...


2

Just to fully document the IUPAC advice on this, here is the relevant section from the Nomenclature for Incompletely Specified Bases in Nucleic Acid Sequences as reproduced here in the link provided by @Hamish McWilliam. 5.2. Modified nucleotides In a number of organisms DNA and RNA are modified at certain positions. For instance, the DNA of Escherichia ...


2

As Amory suggests the IUPAC "Recommendations on Organic & Biochemical Nomenclature, Symbols & Terminology etc." (http://www.chem.qmul.ac.uk/iupac/) are probably the best place to start. From a quick scan the obviously relevant documents would be: "Abbreviations and Symbols for Nucleic Acids, Polynucleotides and their Constituents" "Nomenclature for ...


2

Should I use genomics or/and exomics or/and epigenomics? Depends on what you want to look at. Whole genome sequencing will give you all the mutations. If you are interested only in the coding part of the genome then you can go for exome sequencing. Though, exome sequencing will save your time and resources considerably, you may lose out a lot of relevant ...


Only top voted, non community-wiki answers of a minimum length are eligible