8

So there are a couple of things to bear in mind. pluripotent does not mean that all genes are active. It means that the stem cells have the ability to form different cell types. However, it still needs to keep the cellular programme of a neuron for example silent. So the epigenome is still present to keep other cell type programmes silent until there is a ...


4

Geography does not typically affect the morphology of the human body. In certain special cases, there are physiological adaptations, the most obvious being tanning and acclimatization to high altitude, but these aren't changes in body morphology. So why the difference in children of immigrants? This is because diet, nutrition, and disease have quite strong ...


3

I quickly aligned your sequences, and as far as I can tell, the answer is that your "consensus" sequence is a poor match for the 3 other sequences: CLUSTAL format alignment by MAFFT L-INS-i (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-...


2

By loss of genome, I think he is referring to the shortening of telomeres. This study compares the length of telomeres of human epidermal cells. The authors report that over time, the telomeres do shorten. They also report on the rate of loss of around 32 base pairs per year. Thus there is loss of some genomic information over the age of an individual. ...


1

RNAi can happen in the nucleus as well. This is better documented in C.elegans but there are some references supporting nuclear RNAi in mammalian cells too: https://doi.org/10.1073/pnas.1707440114 https://doi.org/10.1016/j.celrep.2013.12.013 https://doi.org/10.1093/nar/gkv1305


1

Re: In particular, if the underlying DNA structure is changing, then wouldn’t we expect the progeny to inherit these epigenetic changes? Why is it so remarkable? Given the context of the quote, the "variegation" part of the phrase refers to gene expression sometimes being turned off by influence of newly-nearby heterochromatin. The extent to ...


1

Correct me if I am wrong but it seems you are asking 'do epigenetic mechanisms influence cell fate/determination?'. If this is your question, the answer is yes. Epigenetic modifications play a key role in 'deciding' what type of cell a given stem cell will differentiate into. Here is some more information: https://www.nature.com/articles/pr2006122


1

Both Prader-Willi and Angelman syndrome can also occur as a result of having both members of the chromosome 15 pair derived from 1 parent, a condition known as uniparental disomy. Both can also result from a structural abnormality of the imprinting center, known as an imprinting mutation. In addition, Angelman syndrome can be caused by a mutation in the gene ...


1

Jung's premise is rather plausible: consciousness evolved rather than appeared suddenly, and therefore carries "pre-conscious" elements common to humans as a species. However, Jung goes very far in his interpretation of what may be hidden in subconscious, bordering on open mysticism - predicting accidents, wars, etc. I doubt there may be any ...


Only top voted, non community-wiki answers of a minimum length are eligible