New answers tagged

3

I quickly aligned your sequences, and as far as I can tell, the answer is that your "consensus" sequence is a poor match for the 3 other sequences: CLUSTAL format alignment by MAFFT L-INS-i (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-...


Top 50 recent answers are included