Skip to main content
Biology

Return to Question

deleted 20 characters in body
Source Link
SpaceCadet2810
SpaceCadet2810
  • 51
  • 4

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you, Abdullah Chaudhary!

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you, Abdullah Chaudhary

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you!

Tweeted twitter.com/StackBiology/status/864509651060236288
Source Link
SpaceCadet2810
SpaceCadet2810
  • 51
  • 4

CRISPR guide RNA design and primer synthesis

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you, Abdullah Chaudhary