Timeline for CRISPR guide RNA design and primer synthesis
Current License: CC BY-SA 4.0
9 events
| when toggle format | what | by | license | comment | |
|---|---|---|---|---|---|
| Apr 1, 2022 at 8:57 | comment | added | Peter Bernhard | As CRISPR is quite a popular topic, it would be nice to have some basic explanatories for newbies, like: Backward primer is the term equivalent to reverse primer in pcr? More blunty: why do you need a backward primer in CRISPR, at all? | |
| Aug 19, 2021 at 16:43 | history | edited | SpaceCadet2810 | CC BY-SA 4.0 |
deleted 20 characters in body
|
| May 12, 2021 at 6:50 | review | Close votes | |||
| May 18, 2021 at 3:08 | |||||
| May 16, 2017 at 18:17 | vote | accept | SpaceCadet2810 | ||
| May 16, 2017 at 15:55 | history | tweeted | twitter.com/StackBiology/status/864509651060236288 | ||
| May 16, 2017 at 10:03 | answer | added | alec_djinn | timeline score: 2 | |
| May 16, 2017 at 3:49 | comment | added | WYSIWYG |
Is GGAGGCCTCGGGCCGACTCG the output of the gRNA finding software? If so this sequence is most likely 5'→3'. Can you share the output file of the software. If it is an online tool then can you provide the link?
|
|
| May 15, 2017 at 18:23 | review | First posts | |||
| May 15, 2017 at 18:38 | |||||
| May 15, 2017 at 18:20 | history | asked | SpaceCadet2810 | CC BY-SA 3.0 |