I'm trying to design a primer for Gibson assembly. My gene of interest is on a plasmid, and I want to copy that gene, and put it into a different plasmid.
I am unsure how to design my primers for PCR. I know that I need 2 sets of primers (4 total).
- Backward and forward primer to copy my gene out of the plasmid that holds it.
- Backward and forward primer to copy the plasmid.
I also know that I need to create complementary regions of overlap between my gene and the plasmid iI want to put it in. How do I do this?
Here is the Plasmidplasmid and the gene. I want to place the gene in between the biobrick prefix and suffix.
Here is what primers I think I need:
For the plasmid I want to put the gene in, my primers should be
- Forward:
ATTCGCGGCCGCTTCTAGAG - Reverse:
CTGACGCGGCCGCTACTAGTA
Primers to copy gene and add overlap
- Reverse:
ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT - Forward:
AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA
Here is the gene
Here is the plasmid I want to put it in. I am using geneious, but I think for this purpose, word works just fine.
