I'm trying to design a primer for Gibson assembly. My gene of interest is on a plasmid, and I want to copy that gene, and put it into a different plasmid.

I am unsure how to design my primers for PCR. I know that I need 2 sets of primers (4 total).

1. Backward and forward primer to copy my gene out of the plasmid that holds it.
2. Backward and forward primer to copy the plasmid.

I also know that I need to complementary regions of overlap between my gene and the plasmid i want to put it in. How do I do this?

Here is the Plasmid and the gene. I want to place the gene in between the biobrick prefix and suffix.

Here is what primers I think I need:

For the plasmid I want to put the gene in, my primers should be

• Forward: ATTCGCGGCCGCTTCTAGAG
• Reverse: CTGACGCGGCCGCTACTAGTA

Primers to copy gene and add overlap

• Reverse: ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
• Forward: AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Here is the gene

• IodoY TyrRs

Here is the plasmid I want to put it in. I am using geneious, but I think for this purpose, word works just fine.