3
$\begingroup$

Is there an overview over SARS-CoV-2 lineages that have some insertions in their genomes? Tools based on GISAID sequences do not show them.

I am aware of a few lineages with insertions

  • Mu with S:YY144-145TSN (part of lineage definition)
  • B.1.1.28 with S:ins214ANRN (as I understand, only in a subgroup of the lineage)
  • B.1 with S:ins214QAS (as I understand, only in a subgroup of the lineage)—now assigned the lineage B.1.639

I'm interested in lineages that occur in the wild, I am aware of some more insertions occurring in lab experiments.

Improve this question
$\endgroup$
2
  • 1
    $\begingroup$ Please check the meaning of Genetic Code in Wikipedia. What you refer to is called the “genome”. I have corrected this. $\endgroup$
    – David
    Commented Sep 10, 2021 at 16:29
  • $\begingroup$ This is OK with me. $\endgroup$
    – Sir Cornflakes
    Commented Sep 10, 2021 at 16:33

2 Answers 2

Reset to default
2
$\begingroup$

That's because handling insertions is a bit harder than point mutations and deletions.

With covizu I get this, unfortunately it doesn't tell us the insert and the translation. Hope someone can give a more comprehensive answer

    B.1.36.20 ['ins:29594:2']
    B.1.1.373 ['ins:28251:3']
    A.2.5 ['ins:22206:9']
    B.1.214.2 ['ins:22205:9']
    P.1 ['ins:28263:4']
    B.1.604 ['ins:28273:9']
    A.2.5.1 ['ins:22206:9']
    P.1.2 ['ins:28263:4']
    P.1.1 ['ins:28263:4']
    A.2.5.2 ['ins:22206:9']
    P.1.10 ['ins:28263:4']
    P.1.3 ['ins:28263:4']
    B.1.243.1 ['ins:28265:3']
    B.1.621 ['ins:21991:3']
    B.1.1.523 ['ins:26499:3']
    P.1.9 ['ins:28263:4']
    AT.1 ['ins:23599:12']
    P.1.7 ['ins:28263:4']
    A.2.5.3 ['ins:22206:9']
    P.1.4 ['ins:28263:4']
    P.1.10.1 ['ins:28263:4']
    B.1.621.1 ['ins:21991:3']
    P.1.11 ['ins:28263:4']
    P.1.10.2 ['ins:28263:4']
    P.1.8 ['ins:28263:4']
    P.1.6 ['ins:28263:4']
    P.1.5 ['ins:28263:4']
Improve this answer
$\endgroup$
1
  • $\begingroup$ Thanks for the list, this is really helpful. $\endgroup$
    – Sir Cornflakes
    Commented Sep 10, 2021 at 14:31
1
$\begingroup$

With the help of the list by @reuns, I was able to hunt down some of the mutations in terms of amino acids:

  • AT.1 has S:ins679GIAL S:N679K (found in a report from Public Health England)
  • A.2.5 has S:ins214AAG (usually, the insert can have another point mutation to S:ins214ASG, and it can occur reduplicated as S:ins214AAGAAG
  • B.1.214.2 has S:ins214TDR (found in a preprint by Gerdol on Recurrent Insertion Region RIR1, the preprint has some more rare insertions in the same region)

The insertions in lines P.* fall in the small gap between ORF8 and N and don't affect AAs, the insertion in B.1.36.20 falls in ORF10 that is probably not coding a protein.

Improve this answer
$\endgroup$
6
  • $\begingroup$ For B.1.621 (Mu) it is ins146N. The insertion in P.1 (Gamma) is at the TRS, duplicating some part of it. $\endgroup$
    – reuns
    Commented Sep 10, 2021 at 17:07
  • $\begingroup$ Then the game is to guess where the inserts (including a bit of 5' and 3' context) come from. I didn't find any match in Wuhan-Hu-1 and the matches in human mRNA are not too convincing. >A.2.5 AGTGCGTGCGGCAGGCTATCTCCCTC >B.1.214.2 AGTGCGTACAGATCGAGATCTCCCTCA >B.1.604 CAAACTAATTTCTTTGGAATGTCTGAT >AT.1 AGACTAAGGGGATAGCACTTTCTCCTC $\endgroup$
    – reuns
    Commented Sep 12, 2021 at 22:03
  • $\begingroup$ Is it necessary for such short insertions to come from somewhere, can't it be just random? But this is a completely different question ... $\endgroup$
    – Sir Cornflakes
    Commented Sep 15, 2021 at 14:06
  • $\begingroup$ For the 12nt one yes, it must come from some mechanism. Most insertions in viruses are unexplained, but sometimes they are, for example some influenza furin cleavage site come from duplication of a motif, others come from host rRNA. It is still a bit mysterious for me and supposedly the 2.5 million SARS-CoV-2 sequences should improve a lot our understanding. The insertion in P.1 comes from duplication of a motif, at the TRS, binding to the 5-UTR, causing the discontinuous transcription / subgenomic mRNA. $\endgroup$
    – reuns
    Commented Sep 16, 2021 at 13:31
  • $\begingroup$ On virological.org there are now some insertions with putative origins, either from the virus itself or from host RNA: virological.org/t/… $\endgroup$
    – Sir Cornflakes
    Commented Oct 12, 2021 at 16:24

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .