1
$\begingroup$

I have a DNA sequence from a sequencer. How can I determine what protein is it? I tried some translator but it didn't help. What protein is this and how can I determine it?

The sequence: CGTTCTATAGATACGCGATGACGGTATACCATCCGCAAAGT

Thank you very much!

Improve this question
$\endgroup$
3
  • $\begingroup$ Have you tried to blast the sequence? $\endgroup$
    – Chris ♦
    Commented Feb 6, 2015 at 17:54
  • $\begingroup$ Translation would fail on this sequence since it’s not a complete open reading frame (doesn’t start with a start codon, doesn’t stop with a stop codon, and length not divisible by three). As such, we don’t even know whether it’s in frame, or maybe shifted by a nucleotide. $\endgroup$
    – Konrad Rudolph
    Commented Feb 7, 2015 at 13:41
  • 1
    $\begingroup$ Entering fragment in BLASTX helped $\endgroup$
    – Serpentes
    Commented Feb 7, 2015 at 14:19

2 Answers 2

Reset to default
1
$\begingroup$

Enter it in BLASTX. This will give you any protein sequence matches as well as likely homologues given a nucleotide sequence.

Improve this answer
$\endgroup$
1
  • $\begingroup$ Great, I hope that was good news for you! $\endgroup$
    – James
    Commented Feb 7, 2015 at 15:40
1
$\begingroup$

You might want to try searching against NR/NT database using BLAST. This way you will get to know what this sequence might be similar too. The length of the sequence is too short to code for any meaningful protein.

Improve this answer
$\endgroup$

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .