2
$\begingroup$

I'm trying to design a primer for Gibson assembly. My gene of interest is on a plasmid, and I want to copy that gene, and put it into a different plasmid.

I am unsure how to design my primers for PCR. I know that I need 2 sets of primers (4 total).

  1. Backward and forward primer to copy my gene out of the plasmid that holds it.
  2. Backward and forward primer to copy the plasmid.

I also know that I need to create complementary regions of overlap between my gene and the plasmid I want to put it in. How do I do this?

Here is the plasmid and the gene. I want to place the gene in between the biobrick prefix and suffix.

Here is what primers I think I need:

For the plasmid I want to put the gene in, my primers should be

  • Forward: ATTCGCGGCCGCTTCTAGAG
  • Reverse: CTGACGCGGCCGCTACTAGTA

Primers to copy gene and add overlap

  • Reverse: ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Forward: AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Here is the gene

Here is the plasmid I want to put it in. I am using geneious, but I think for this purpose, word works just fine.

Improve this question
$\endgroup$
4
  • $\begingroup$ your gene is 5kb long.. you cant assemble it with 4 primers.. BTW.. why do you need to assemble it ? you can do a normal PCR.. easier $\endgroup$
    – WYSIWYG
    Commented May 17, 2013 at 9:33
  • $\begingroup$ @WYSIWYG the TyrRs gene is just 1920 bp of the plasmid in the linked file. $\endgroup$
    – Alan Boyd
    Commented May 17, 2013 at 10:50
  • $\begingroup$ @AlanBoyd.. that would still require more than 4 primers to assemble it.. To assemble a ~320bp fragment I used four 90mers.. $\endgroup$
    – WYSIWYG
    Commented May 18, 2013 at 7:54
  • $\begingroup$ Marco... I think what you want to do is a nested PCR.. in gibson assembly you assemble the entire DNA fragment using several small oligos.. $\endgroup$
    – WYSIWYG
    Commented May 18, 2013 at 7:57

2 Answers 2

Reset to default
2
$\begingroup$

Disclaimer: I haven't ever done a Gibson assembly, but here is my theoretical understanding of how to design your primers. You need four 40mers each consisting of 20 bp segments derived from the vector and the insert and corresponding to the junctions that you are trying to create. In the diagram below the dotted lines represent the junctions between the two 20 bp segments of each 40mer.

enter image description here

Improve this answer
$\endgroup$
1
$\begingroup$

Here is a good overview of primer design considerations when using Gibson assembly. http://j5.jbei.org/j5manual/pages/22.html

Improve this answer
$\endgroup$
5
  • $\begingroup$ it says can linearize the plasmid by cutting it and so you'd only need 2 primers to clone the insert. what advantage is there clone the vector as well? I guess it saves a miniprep, but 2 oligos cost more than a miniprep does.. $\endgroup$
    – shigeta
    Commented May 21, 2013 at 12:58
  • 1
    $\begingroup$ Well the downside to cutting the vector is that a restriction site must already exist at the junction. This is a major limitation that Gibson overcomes. The potential downsides of using PCR to amplify the backbone: you might have problems getting PCR to work (always a potential problem), and there is a minimal risk of introducing mutations during PCR (but phusion polymerase should give very few mutations). $\endgroup$
    – Mark B
    Commented May 22, 2013 at 7:11
  • $\begingroup$ Most vectors do have convenient cut sites, but I can see that this is convenient in a lot of ways and it would be quick to order new oligos for the vector. i really want to try this in the lab... $\endgroup$
    – shigeta
    Commented May 22, 2013 at 12:35
  • $\begingroup$ @MarkB would you be able to edit your post to summarise some of the content of that link in case it is not around in the future? $\endgroup$
    – Rory M
    Commented May 27, 2015 at 17:56
  • $\begingroup$ This link helps to answer the question, but on Stack Exchange we prefer answers which don't depend entirely on a link to another website $\endgroup$
    – Luigi
    Commented Jun 10, 2015 at 22:16

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .