1
$\begingroup$

I want to design a forward and reverse primer that include overhangs with restriction sites, with the dna used for restriction enzyme cloning.

If I want to send my dna to a synthesis company should I include the attached overhang with the restriction sites to the dna? Does it matter if the primers have the overhang of the dna within their sequence ?

From the sequence right at the end what bp sequence would be recommended I use for my primers if I want approx. 20-25bp for the primer?

See below for cDNA sequence:

Nde1 cut site: 5' ... CA|TATG ... '3'

Xho1 cut site: 3'...GAGCT|C...5'

cDNA with overhangs that have restriction sites, Ndel1 (5'->3') and Xho1 (3'->5')

5' catatg - ATGGGTTCAAACACTTCCAAAGTGGGTGCTGGTGCAGAAAAACAACAAGTCTATACTCCG
CTAACACAGATCGATTTTTCACAGTCTTTGGTTTCTCAATTGGATTCATCGAAGGAATCA
GACTATGTCACCAAGCAAAATGCAGAAAAGTTCATTGAGAAGAAGGTTTCACAAAGGCTA
TCTAACCTAGAAGTTGAAACGTTAAAGAAGTTTGAAGATACTTTGAACAATTCACTATTA
TCAGACGACGACAAGGATGCCGTTGATGGAATATCATCAAGTTCATTGAATAATCAAATC
GAGTCGTTGAACAAGAAACTAACATTATTTGATCAATTAGAGTTACAAAAGTTGGAGAAA
TATGGGGGTGCCAAAGGTAAATCTGATAAAAAAACCGACAACGGCAGCATTTCTATAAAG
GCAAAATTGACTGAGTGTCTTTTGGCCAATAAGGGCAAGCCATTGAATTGTTACGAAGAG
ATGGAAGAATTCAAGAAGCTCGTTATGGGTTGA - gagctc 3'
Improve this question
$\endgroup$
3
  • $\begingroup$ I've added an answer, but I don't fully understand what you mean when you say: >"From the sequence right at the end what bp sequence would be recommended I use for my primers if I want approx. 20-25bp for the primer?" Are you asking us what sequence you should use for the reverse primer? $\endgroup$
    – Joe Healey
    Commented Jan 11, 2017 at 10:46
  • $\begingroup$ Yes I was just wanting to get an idea for the primer sequence, or essentially if I could just start (i.e including entire overhang) the primer right at the start of the overhang $\endgroup$
    – astrakid932
    Commented Jan 11, 2017 at 11:45
  • 1
    $\begingroup$ Your priming sequence should be the reverse complement of the last ~20bp of the coding sequence. Add the restriction site at the 5' end of this, then your overhang after that. All in all your primer will be 20+6+3= 29 bp $\endgroup$
    – Joe Healey
    Commented Jan 11, 2017 at 11:50

1 Answer 1

Reset to default
1
$\begingroup$

Yes.

If you intend to subclone the fragment via classical restriction enzyme cloning you need the overhang.

Different restriction enzymes require different lengths of overhang to allow them to sit fully on the strand and then cleave the sequence.

NEB has a great page detailing how many bases are needed for the enzymes they sell:

https://www.neb.com/tools-and-resources/usage-guidelines/cleavage-close-to-the-end-of-dna-fragments

No, it doesnt matter if the overhang appears elsewhere in the DNA, just so long as your restriction sites don't (obviously).

Here are some considerations I use when designing primers for PCR (though not wholly applicable if you're just having it synthesised):

  • Use the 3+ basepairs present the given number of nucleotides in your restriction site away in the sequence you're PCRing from as your overhang sequence to allow a few more bases to bind. I.e

    With the following primer:

    Overhang - Restriction Site - Priming sequence

    AAA-GGATCC-ATGACATGCAGTAGC PRIMER

    ||| |||||||||||||||

    TTT--------TACTGTACGTCATCG TARGET SEQUENCE

  • Alternatively, I use those 3 or so basepairs to add or remove GC content and manipulate the Tm if the annealing temperatures of the 2 primers aren't ideally matches

Improve this answer
$\endgroup$
6
  • $\begingroup$ Thanks that makes sense, but if the restriction enzymes I am using cut the overhangs they are also going to leave a few base pairs upstream and downstream of the actual gene, will this cause framing issues or doesn't it matter where the GOI is inserted in a plasmid MCS? $\endgroup$
    – astrakid932
    Commented Jan 11, 2017 at 11:26
  • $\begingroup$ To fix framing you should / could add bases in between the restriction site and the fragment of interest. But as your NdeI ATG is in frame with the start-ATG I don't expect any problems. You could even remove one of those ATGs if you want. $\endgroup$
    – VonBeche
    Commented Jan 11, 2017 at 11:31
  • $\begingroup$ Ok so should I delete TATG from 5' ... CA|TATG ... '3' (Nde1) and C from 3'...GAGCT|C...5' (Xho1)? If I add bases wont that just create blunt ends? $\endgroup$
    – astrakid932
    Commented Jan 11, 2017 at 11:37
  • $\begingroup$ The only concern I have is the space the leftover base pairs creates upstream, not really sure if this will affect translation $\endgroup$
    – astrakid932
    Commented Jan 11, 2017 at 11:43
  • $\begingroup$ The overhang will disappear when you digest with the restriction enzymes. the only sequence that will persist is the restriction sites that allow seamless incorporation in to your vector. The extra bases of the restriction sites can't be translated as they will be before your start codon, and after the stop codon. If this doesn't make sense to you I'd suggest reading up on the basics of cloning in Sambrook et al or another good textbook. $\endgroup$
    – Joe Healey
    Commented Jan 11, 2017 at 11:48

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .