4
$\begingroup$

I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:

GGAGGCCTCGGGCCGACTCG Strand (-)

The next step for me is to design the primers with the following sticky ends

Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'

The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.

Thank you!

Improve this question
$\endgroup$
2
  • $\begingroup$ Is GGAGGCCTCGGGCCGACTCG the output of the gRNA finding software? If so this sequence is most likely 5'→3'. Can you share the output file of the software. If it is an online tool then can you provide the link? $\endgroup$
    – WYSIWYG
    Commented May 16, 2017 at 3:49
  • $\begingroup$ As CRISPR is quite a popular topic, it would be nice to have some basic explanatories for newbies, like: Backward primer is the term equivalent to reverse primer in pcr? More blunty: why do you need a backward primer in CRISPR, at all? $\endgroup$
    – Peter Bernhard
    Commented Apr 1, 2022 at 8:57

1 Answer 1

Reset to default
2
$\begingroup$

A quick check with BLAST returned the following result:

Homo sapiens huntingtin (HTT), mRNA
Sequence ID: NM_002111.7Length: 13669Number of Matches: 1
Related Information
Gene-associated gene details
GEO Profiles-microarray expression data
PubChem BioAssay-bioactivity screening
Range 1: 267 to 286GenBankGraphicsNext MatchPrevious Match
Alignment statistics for match #1

Score           Expect  Identities  Gaps        Strand
40.1 bits(20)   0.017   20/20(100%) 0/20(0%)    Plus/Minus
Query  1    GGAGGCCTCGGGCCGACTCG  20
            ||||||||||||||||||||
Sbjct  286  GGAGGCCTCGGGCCGACTCG  267

The sequence you have is 5'-3' and it matches the Minus strand on the human genome. You don't need to reverse the sequence!

Here is a screenshot from IGV showing the gRNA sequence matching the minus strand of the HTT gene.

enter image description here

Improve this answer
$\endgroup$
2
  • $\begingroup$ For those unknowing it would be nice to have some more information. The question is right in assuming the sequence is negative according to your answer (how can you tell by that sheet?). The question then says "hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer." That conclusion, implication is not correct. That's what you mean? For the forward primer, what you need is the 5'-3' sequence? "You must not" reverse? $\endgroup$
    – Peter Bernhard
    Commented Apr 1, 2022 at 9:02
  • $\begingroup$ @PeterBernhard the gRNA sequence is written in 5'->3'. There is no need to reverse it. If you see the BLAST output, the Query sequence matches perfectly a minus-strand. Note that the minus strand coordinates are from 286 to 267, indicating that the Sbjct sequence is already reversed in the output. The gRNA sequence is already in the 5'-3' order, so there is no need to reverse it. I have added an IGV screenshot showing the gRNA sequence matching on the genome, I hope that will help clarify. $\endgroup$
    – alec_djinn
    Commented Apr 4, 2022 at 7:42

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .